Echinops_telfairi Locus Mono:540:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:540:SNORA61
Echinops_telfairi
Mono:540:SNORA61
GeneScaffold_7152
SNORA61
1001..1118
2118
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCTGGATATGTCTTCATCTTGTCTGGGTCACTTTTAAAACTTAATGTTTTCTAAAA
CAAACAAACTTGAGCACTGCCTCACTGCAGACAGTTAACTATACCTGCAGCATAATGAAA
ACATACATGTATGAGGTAGAAAATGGGTGAAAATTGTCTATGAGATTTGTTCTGGCCTTT
CTATAGTCGTGTATAAAAGTTTGTACTCAATATAACTGAGATATTATCAAGGAGGGGAAA
AAAGGACTAATAAAATAAATCTAGGCTTCATTAACCTACAGTACTTCCATAAATACTGAC
TGAAAGTACTCATTCGTCTATGCCAGGAAATTTAGAAGATAGCTACTTGGCCAAATGACT
GGAAGACCATCCATATTTGTACTTATTCCAAAAAAAGTGACCCAATAGAATGCCAAACAA
TTGAACAATATTATTGATATCACACATAAATAAAATTTTACACCCTCCAGTTCCCTTTCC
CATTGGATCAAAACACATCTGGGTGTTCGTAAAAGGAGGAAAAGAAACATTGAAGCTGGC
CCTCAGTGCTCTTGGAGCTCGGGCTAGTTCCAAACAGGGTAAAAATAAATTAATAAAATA
AATATATTTTTTTTAATTTTGCTGAAGATCATCCAACAAAGGTTACAGCGGTACATTGAC
AAAAGAATTGCCAGAAGTTTAGGACAGATTTGAAGAGGACATGGAACAAGGGATATTGCT
GATGTCAGATGGAGCTTGGTTCAAAGCAGAAAATAGGAGATGTTTACCTGTGTTTCATTG
ACTACGCAAAGGCAATAGACAGTGTGAACCTAATAAACTGGATAAATAACCTTGAGAAGA
ATGAGAATTCTAGAACATTTCATTGTGGTAATTCGGAACTTGTACATGGATCAAGAGGCA
ATTGTGCAGAAGAACAAGTACATGCTGCATGGTTTAAGATCAGGGAAGGTGAGCCTCAGG
GTTCTATTCTCTAACTGTGCTTGTTCAATCTGCAGGCTGAGCAAATCATTAGGGAAGCTG
GGTTATATGAAGAACAATATGGCATCAGGATTGGAGGAAGGTTTATTAACCTGCAATATG
CAGATGACACAACCTTACTTGCTGAAAGTGAGGAGGACTTGAAGCACTTGCTGATGAAGA
GCAAGGATTGTAGCCTGAGTGGTAAAGACAACAACTCAATGTAAATAAGACAAAAAAAAT
CCTCACAAGTGGACCAAAAGGAAACATTGTGATAAATGGAGAAAATGTTGAAGTGGTCAA
GGATTTTGTCTTGCTTGGATCCACAATCAATACTTACGGAAGCAGCAGTCAAGAGATCAA
AAGATGCATAGCTTTAGGTAAATGCGGTGCACTAGTCAGTCCTCTTTATATTGAAGAGCA
AGGATATTACTTTGAAGACTAAGTAGACCCAAACCATGGTATTCTCATATGCATGTGAAA
GGAAGACTATAAAAGTGAAGCATTTGAATTGTGGTAGTGTAGAAGAATACTGAAAATACA
ATGGACTGCTAAAAGAACGAACCAATCTGTCTTGAAAGAAGTCCAGCCAGAGTGCTCCTT
ACAGGCAAGGATATTCTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved