Echinops_telfairi Locus Poly:7:SNORA32
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:7:SNORA32
Echinops_telfairi
Poly:7:SNORA32
GeneScaffold_7616
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32
1001..1127, 2357..2490, 3492..3630, 3849..3979, 5187..5307
6307
TCTACTTTTATCTTGTATTTTCGTAGAAAGCTTACTTTTCAAAATACTGCGTAAATTTC
AAAATGCTTGCATTTTGTTTTGGAAAGACAAGTTTTCCCCCAAACAAGCCAGGCTTTGCA
TGAGTTAATGTGGGTCTTAGCTCTAGATACAGGCACAAGGTACTACTGAAGTAACCAATC
ACCGTTGTGTTTTCTACTTTATACAGGAAGATAATTGCTTTATAATAAGTTGTGAATTCC
CAAAGAAGAGGAAGGCAAATTTAGACGAAGACAATACTGAAGATGTTACATTGTTTAGGA
AGGAAGTTTCTAAAACAAAGATACTGGGCAAAAAAGAGGACGGAAATGACCTGAACGGAG
TCAAGAATAAAAATGTCAAATGAGGTAAAAAGAAAAAGCCCTTGTTCCCAGGAAGGCGCT
GAGACGTGGGCATACATGCCAACATTGATGAGATTCTTGGAAGAGATTAGTAGAATGGAG
CCTATATTTTATACCTGTGAGCTGCTCTATGTAGGAAAATCTGGATATCAGAGAAATTAC
TTGCTAGAAGTATTCTGACTGTGCTTGCTGATAGTGTTTTATTTCAGAAATAGTGTTTCA
ACACTGCACCAATTTAGTTGAGATTTTGAAACCGCCCTGCAGAGAAAAGTCTGATTGGCT
GACAGCTTGGCACAAATTCTGTGGTACCTGCTTATTTGCAATTTTCATTTTGCAAATGGC
TTCCCATACAAATGCCAACCACCTAAAACTCCCAAGTGCTAATTTTCATATTTATACTTG
TCAGCAGCCTATTATAGTAATTTAAGGGGACACTGGCTGTGTAAGTAAAGTCCTTGGCTG
CTAAGTAAACTACCTGTGGCTGCTGAGTAGGAGAGCCTTGTTTGCCTCTGAAGATTTGCA
ATCATGAAGCCCCATTGGGTGATCCCATCTACTGTATCCTATTAGGGTATGTATGTAAAT
ACTCTGCTTTTATATAGGGTCATATCCTACAGTTGTATAACTGCATTTGTGTTTGTGTTT
GTTTAATTAGTGGACAAACACTCAAAGACAGGTGCAAGAATAAATCCTCTTTTGCAACCC
AAAACTCATTGTGCAGTATGAGTTTTGATACAGATAAGAAGGGACATGTCATTAAACCAG
TTACTAGAGCACAGTGTCTTGACAGTTGTGGACACTTCCCAGGACTTGCTTTTGAGGGCT
TCAGACGAAACATCAACCAGGTAAGGAATGTGCCGACATGACAATGGGCATTTAAAGCTG
TTGTGTATTGGAACTTACGTTTTACCCGAGCAGTAGAGTAGGTCATAAAGGCTATCTTGG
CTGCATTTTAACATTCTAATCTTACTTATTACCATGAAACATTAAGATTGTCTCCATTTT
TTTTAGACATTTTATCTTGAACCTGATGCCTGGACTTTCAGGTATGTCTAATGCTTTTAA
GCATGAAATTTTTAAAATCAGTTGTCAGTGTACAATGTCAAGTAATTTTAAACTATATTG
GCATTTTACTAGACCTTTGCGGGGAGGAGTCTAATTGTCATACATTGATCTCTAAATATT
TCATCATAAAAGTAGGGCACCATCTCTATCTTTAGGAGAGCTAGAAAACTTAAAAAGGAT
CATAGGGATTTAAGTTATATTTTATGTTCTTGCAATGGATATTCAAGAATATATAGTATA
GTGGAAATGGCTTTATTTCTGAAATGTAAATAATTTAGATGTAAAGTTCCCTGTGTTAGT
CCCTTACTATCATTACTGATCTTGCATCGTAATTCCCATATGGAAAGTGATTTTAGGCCT
CACCTTACAAAATTATCCTTTCTCATCACAAGCAGCCCCAAGTGGTACTTGATCCCCAGC
CACCCTGGGCTAGGTCAACACCTTGGGATCCACTGGACCCACTCAGATCACCACACCTGC
ACATTTAAGGATTTTCTCTAACCTTAGTGAGCCTCACCAATGATTCACGGTGGATTTTGT
AATTGATAGCCTTGCTGGCTCCCCTAACCCCTGTGGGTGAAAGGTGCAGGGCAAAGCTTG
AGAGGTCAGAGTAACAAGTATCGACTCATCCATCCCATGGCTTCTATAAGCTGAGATGCG
CACCTTGGTAAACCGTTTCTTTGAGACTCCTCAGTTGAGCCTAAGTTTTGAACTATGACC
CCACTAAGTTGAAAGGCTGAGCTCACTGTAATTGCACTTGTTTTGTCAGAACATAACTAA
GTACACAGTGATCGATTTATTCTTGAGTGATTGAGATCTATAAGAATTTTGGTTATTTTT
TGCAATTTGTGTTAATGAGAAAATCAGGGCAGGGCAGATGACAAATCATTAGTATTCATT
GGACTGTGTTCTTGATTGTTGAGGTCTATCCCGATGGGGCCTTGTCTGTAGACCCACATC
GTTGGAAACGCCTCACAGAGTAACTCTGTGGTTTGCTTTACTCGCAGAACTGCTATTGGT
TGGATCTGTGAGGAAGAACTACAAGACAAATTTGTAGATAGTAGGAACAATCTAATAGGT
ACTTGGTTTTGATCCTAGGTATTGGTGTAATCTGCACATTTCTTAGGTAAGTTTAAACTG
ACTTAAAATGTCATCTTTCACCATACTGGTACATATAGTTCATGTGATGAATTTAACTGT
TCAACTGCTGAATGATACAGACATGAACTAAAATCTTCATTCTGATTGAGCTTGATAGAA
CCCAAGAATGCACTTATTAAACTTAACAATCAAGTAATTTTAAATCTTTTTTTTTAATAT
TGTCACCATAGGGACTGCCAGGGATTACAACTCAGTGTTCAGGTAAGTCCAATATGCTGA
TTAAGTGATTCCATAGTTTAGCAATAAACTACATAATTATGATTTTGGGAAATAATGTCA
TTCCATCCTTTGCATTTTCCCAATAATTTTTTTGAAGCCTCAAGTTTACATGTAGGAAGA
CAAGATGGAATAGGTTGGTTGATTAAAATGAACTTCATGTTTCTTTTGGAATAATGAAGG
CTAAAGGCCAAGTGCCTATTATAGGAATGCTGTATTTTAAGACATTATTTTTGAGATCAG
TATGTGTGTTAGACAAGGAAACAACCAGGATAACGGTTTTATAGATCTGTTTAGCACAAA
GGAATGTAACAGCTAATTAGTCCACATAGCAGTACAGAAGGCTCAGTTCAACTCAATAGG
GCTGCTGGGTTCAAGGTCAAAGAAGCAGACAGCTGAGTCTTCCAGAGAGCAATGCAGGCA
GACTAGCCAGCAAACAGCAGGGTGGATCTCCAACAGTCAGCCAGATGACAGGAAATGACA
GTCCCCAGGTTAAGAGATAATATGCACCAGCAGTGTGTAGAAGCAGGTACACAGGCAGTG
TAGCTCACAAGTTAAGGCAATGCACGCTGATCAGATTACCAGAGGGGGGGGGGGGGAGAC
CTAATTTCCTACTGGCCAGGTTGGCACAAGAACCTTACCTATCACAGTATGCCTGTAAAC
TGCAGACCTCACAGCACTGCATGGTATCTGCATCCAGCAGCCTTTTCCTGCTGGGGTGTT
CAAAGGACAGTGCAATAGAAATTCAGTATCTGGCATCGTTGGTTTTCTTGGCTTTGTGCA
TGTTAAACCTGGTATTTCTATTGATACAGTTCACATAATTCCTTTGAATGATAACCTGCT
TGTTGATAAAATGTTAGGAACTGATTATTTTCTTTTTGTAGGGTATCTGAAATTGAGAGG
AAGGCAGAATGAATGAGATCCAAAGATGTATGTAAGGCTTTCTGTTCTTGTCTTAGCAGT
TGGCTGTTCCTTAGCAACAAACTTCCTGCATGCATGTAGAAGTGTAGCGCTGAGGAACTG
CTTGCATGCAGCCTCAGTCTGTGAAAGTGGGCACAGCTGATCACGGTGTCCAGACAAGCA
GTTGTGGCTGAAAGGATGACAGGTTTTGCTTCCACCACTGTGGGTTAATTTCAGTGGTGA
CAATGAGACCTGTAACACTTTGCTCAAGCAATACTAAAAGTTAGCAATGTAGAAATATTT
AGCACTAATACTATTTACTCCCAAAACATAAATGTACTTTCTACTTCTAGGGCCCTAAAG
GGAATAACAGAATTTTCAGGTATGATATTATTTCAAAAAGGCAAACGGTTGGCTCTAAAT
CATGTTAGCATTTTTGCGCCCGCCCCCCCCACCCGCAAATTTTATTTCAGCATCATGGTT
CTTAGATTTATTTCAAAGTCTTGGTAGCATAGTGTTTTATCATCACTACTTTATTAATGA
TATAGAAACATGTTAATTCCTTAATTACTCAATGTATACATTCTGTGACGGGATGTTATG
ATGACAGGCAAATTGTTCAACTGCTCTGAATAGGATGAGTGAAAATGGCCTTTCTGAACA
TCCATGTACATTAAAGATTGGTCTCAAGTAATATGTGAAAAAAAGCACCTTTTATTTTGG
GGGCTCACAGCTCTTCTCACAATCCATGGTGTCAAGCACCTTTGTTACATAGGTTGCCAT
CATTTCCAAAACATTTTTCTACTTGAGTCCTTGGGATCAGCTAATTTCCCCCCTCCCCCA
TCCTCCCTCATGAACCCTTGATAATTTATGAATTATTTTTTTTCATGCCTTACAACAACC
ACTGTCAATCTTCACGCGCTTTTCTGTTGAACGTTCCACTGGGAGGGAGTTATGTCAGTC
ATTGAGATCGGCTCCCCTTACCTCCCCCCACCTTCCCCTCCTGGTGTCATTTGTAATGGT
TCCTTGGGCATACATATGGCAGGGTAGATAGGGGTAAAGGGGGAGCTAACAATTGAGTAC
AAGAGGAGGAAAAAGCCTTAGCTCTTGATGTCATTGAACTATTTGATATGCCAATTATAC
CAATAAAACGTGGTTTAAAATAAAAGACACGATGTCTGAGAAAAAAATGCTTGCAAGTAG
TAACCAGAACATTTGTGTCTGTTGGTCCAGATGCAAATGGGAACATTCAACTTCTTTAAT
TTCTCCTATGTATTGTTTCCAAAAACAATTTTAATGCATAAAAAATTGTATTGGGTTTCT
ATTTGCAGTGTAGATAGATACTAATTTGATCTTTTTTTCATAGGCATGAAATGTTTGACA
TTTGTCCATAATGGAGGTTAAAGTGGTGTAACCAGAAGTATTAACAGGTAATTGGTTTCC
CTTTATAAACTGTTTTCCAGTCTACAGTGGTCATTACCAAGGCTTTTAGAATGTGGTTTC
TGATTTGCTGTGGACATGACCATAGACAATTTCCCAGGAGGTTTTTGTTTTTGCTACCTT
GCTAGCATATAACCGATTGGGGACATTGCTGAAATGTACACTACACTACAAAAAGATTGA
AGCTACACATTTTCTATAAGCCTTATACTCAGTAAAATTTTGTTTCTGCTTTTTCAAGGT
CTGAGATTAATGCTTACTAGACAATGGTGGCTCGTGGCTCCTTACAAAGGTGAGCGCACT
TTAAAGTCAGGTCATTTCAAAGCGGGCTTATGGAACTGAGATCAAGAGCTCTTAACGCCG
TGACCACAGATAGTCTCCACGGAATGCCATCGACCTCCACAGTGCTGTTTCCTGAATGTA
ACCATGTATCTCCACAGGAGTTTATAAAAACATGTGCCAAGTTCAACCAAGGGGTAATTT
TTTTCTTACCAGGGCTATCTTGAACTTTTGCAAAGATATAGAAGAACCAAATGAGAAGAC
AAAGAATATGTAAAACTCCTTAAATAAAATTTATTAATATTAAATAAAATCTATAAAACA
AAAATGTTTACAGTGCAGAAAATCAGCGTGTATTTCTGGCTTGAAGTTTCGCTAATGTTT
TCTGTGGGCGAATGAAAAAAAAAACAACCAATTAGAATGAAAGGTCTGGCTACCTTTAAA
AAGTGGCCCTGGGAACACACATATACACACACACACACACACACCTTATGGAATTCTCTA
GCCCTCGCTCTATTTTGGGCATAAGCTTCTTGTGTTGCCTTTCTTTCCCTTTGATGTTTC
ACTTCAGCTAATTGATTGTATGACCTATAAAAAAATCAGAATTAGATTGACAGACAATAT
GAAAGGAATTTGAAAGTTTACATTAAACCAAGTTACCTCAGAGTCCTTTGGTACATGAGG
GCTTCTTCTGATTTTCTGTCTTCAGGGAGAGAGACTTTACTTTTCAGTTGGTTTACAGAA
GAGCCTTTGAGAGAATACATTGTTATGTCAGTATTTTTAATGGAGAAAAGCCCTTAGGAC
AAGAACCTAGTTGCAACATACCTGTAGGTTTCACTACTGGAGGGTTTTCAGTGACTCTTA
TAGCACGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved