Echinops_telfairi Locus Mono:222:SNORA41
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:222:SNORA41
Echinops_telfairi
Mono:222:SNORA41
scaffold_206865
SNORA41
1001..1130
2130
AGTGTGGTGAAGAACCAGATAGTGCCTGACTATCAGACAGATTAGCACCTAGGTTATTA
AAGTCTTGTCTTAAGACAAGTAGCCATCTAAATGAGGCATCAACTAAATCCACATGAAAG
AAGCTCACCTAGCTGTGTGATCCAATGATTTTAAGTAATAAAATCCAAATACAACGGAGG
TAACAGTATCAGGGCTTAAATTATGAATCCCCAGTATGCCAAAGACTATGGATGACTAAG
GAAGCCCAACATCCATTTGCAAGGACCCCACAAGGATTAACCCTCTAATGAATCCCCTCT
AACCATAGCCCAGGAACATGAAGACCCTTGATAGGTGACAAGGGGCATTCTAAAGCAGAT
TATGACAGCTATATTTAGGTGAAAATGGAATGTCTTATCATGTGAGCTCCCTTTTGACCC
ACTTTGAAGCAGTTTCAGCTTTCTACTTTCCTTTGGTTTGAGGTTCTTCTATGTTTGGTT
TTGTCATTGTTGTTGATTTTGTTTGCTTCTTTCTTGGCTTCCTGGTTGTGTTTTTTATGA
TATGTATAGGAAATCCAGGCTATCCTGGATATCCAAAGAGATAGTAAAGGAATTAATAAT
TACCTAAGGACATGGCAGGGGATGTTGGGAGGAATTGGGGAGGTAACAACAATGAGTAAG
AGAAAGAAGACAATATTGTGAAATTGATTGTGGTGGTGATTGCACAACTCTTCTTAATGT
GATTGAATGATTAAATGGTGCAAGATGTGAATTTTGTATATGCCAACAAAACTGGAAAAA
AAAAGAAACGCAACATCATAAACTCAATCTAAACAACTAGATCATAAATTAGGGGAAGCT
CACCCAAATTGTCCCCACCATCAGTGTTTGAACAAGTTCACCAGGTGATTTTAATGCAGA
ATAAATTTCAGAAACATTGGTCTAGTCCATTTAATATCAAACTTGACAGTGCATTAGAAT
TATCAGGAGAGCATTAAAAACCAAAATAAACCACTGATATTTTCCATATTTACTGGTCTG
CAACTGTTCTTATGATAGTCAATGAGTCAGTTCTCTGTGGAAAAGAAACTGTTACACAAT
TGAAACCTCCTTTCTAAAAACATCAACTGGACATATGTGTGATGGATACAACAAAAGGCA
AAAACACTGATGCCTAATTTCCTTAGTCAATGATTCTGACATTAAATATGTTCACATTCT
TTTCAAATCCCAATGGAACATTTACCAAAGCAGTCCATATCCTCAGGCATAAAACAAGGC
TCAATGATTTTAAAGGATTCAGATTTTAGGAAAATATTTTCTTTGCCTACAATATAGTTA
AATGAGAAAACATTAATAGAATGATATATGGAAAATCTCCAAATATTTGAAAATAAATCA
CACACACTTAAATATCCAATGAGACAAGTAAGACATCAAAAGAGAAATTAGAAAGTATCT
TGAAGTGAAGAAAAATAAAAACATTATATATCAAAATTTACGGGCTACAGCTAAAGCAGT
ACTAAAAGAAATTTATAGCACTAAACATCTATGTTACAGAGGAAGAGAAGACTCAAATTT
ATAAAAAGAGGAGCAAATGAAAGACAAAGTTAAACATAATTAAGGAAATGATAAATATTA
GAGAAAATATTAATAGAAAAAACAATAAAAGAAATCAATAAAAAATGTAAAGCTTTTTTT
TTAAGATCAATATGTGACAGACTTCTCAGCAGACTTGTCATTAGTAGAAGGAGAAGACAC
ACAGTACCAATAATAGGAATGAAAATGTGATATCACAGTGGATACTACAGATGTTAAGAG
GATTATGTAGAAATACTGTGATCATCTTGACACTGATCATTTCAATAATTTAAATTAAGT
TAGCAAATACCTTGAATGACACAAAAGAAAGTTTATGAAGCCCTAAGAATGAGCAATGTG
TAGTTTAAATCCTTTACCTCTTACTTAAAAAAAACCTTTGAGCTATCATGATTTCACAGG
TGAATTCCACCAGACTTTTAGGGAGGAAAAAATATAAAATATACACAAACTCTCAGAGAA
AAGCTATTTCTTAACTCACCATGTCCGCATAGCATCACCCTAATGCCAAAATCAGATTAA
AAAATTTCACACACACACATATACACAAACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved