Echinops_telfairi Locus Mono:600:SNORD48
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:600:SNORD48
Echinops_telfairi
Mono:600:SNORD48
GeneScaffold_8992
SNORD48
1001..1063
2063
TTGGGATCATAATAGTGGGGGGTGAGGGAGGCGGGGTGGAGGTGGGGAGGAAGCATTTA
GGAACCAGAGGAAAGTTGTATGTTTCATCGTTGCTACACTGCACCCTTTAAAAAAAAAGA
ATTGCTTTCCCTGCACACAATGCTTCTGTCAAAACTCATTTGTGAACTTACAAAATTTCT
CACCCACAACTTGCTATCCTGAACAGTATTGCCTCAGACCAAGGGACTCCAAATAAAACA
AAGTGGGGCAATGTACCCAGGCTCATGGAATCTATTGGTCTTCCCATGTTCCCGATCATC
CTAAAACAGCTGATAGAACAATGGAATGGCCTTCTAAAAACATAATCACATCACTAGCTT
GATGGCAACACCTTGCAAGATTCCGGCAACGTTCTCATGATACTCTATATGCTATAGACC
AATGTCCAGTGTATTGTGCTGTTTCTTCAATAGTCAGAATTCACAGGTCCAGGAACCAAG
GGGTGGAGATGGAAGTAACACCACTCACTATTACTTCTAATGACTCTCTCATCATATTTT
TGCTTCCTCTCCTTGCAATCCTATACTCTTTGGGTCTGGAGGTCTTAGTTTCAAAGAGAG
AAATACCACCACTTGAACATGCAGCACTTTTTCCATTGAACTGGGAGTTAAGAATGAATG
CCTTCTGGCCATTTTGGACTCCTGTGCCTCAGGATCAGCAAACAAATAAGACATCACTGC
GTTGAGTGATATGATTTATCTTCACTACCAAAGGGAAATTGGATTAGTATGCATAATGTA
GGTAAGGAAGAATATTCCTTAGGTTATCTCTTTGTACCACCATGTCCTGTGATTAAAGTC
AATAGTAAACTCGAGCACCCCAATTAGGGCATGACTACTACTACCTGAAAGTCTTTAGAA
ATGAAAGTTTGGGTCACCCACCAAGCAAAGAGCCACGACTAGCTGAGGTACTTGCTGAGA
GAAATGGAAATATGAAATAGATAATGTAAGAAAGTAGTTCTGGTGGTGATGACCCCCGGT
GATTCTGAGTGTCTTTGCTGATGCCATCACGCAGCACTCTGACAATTCCTCTGCCCCACA
GGCCTGGAACCCTAATCCCTGGGTTTGGGGAGAAGCGATGAGTCCTTGGTAAATTCATTT
ATTCTTAATTCCAGCACCTCAATCCGTCAGGGCAGCGTCATTGAATAAAGTGTGAGAGCC
ATGGCAGCTCAGCCAGTATCCCTTCTCAGCATGGCTGCATTAACTTGATTACTGAAGGCA
GAAGAATTGGAGTTTACCTTCTTGGAGAAGTACTTTCAGATGCCTCGAAAACTGACAAGA
AGTAGAGACTCATGCCCCTTCTGAACTATGGCTGCCATGGATTTTACATACACACAAGAA
TGTGTCACCTGCCTGGTGTTGGACAGATCCTGAGGACTTGAGACATCTGTTCCTGTATTT
ATTACCATGAGAAACTGACAACTGAAGTATCTCTAGAAATACTGGGTTACTTAGTGACAA
GCAGAGGGCTTTCACTTGTATTTCATTATCTCTTATATAAGAGCCTGTTTTTTAATTGAT
CTCAATAAAATGTTGATAAGTTAAAAAAATAAAGTAGTTCTAAATACTACCTGTGTCCAC
ATAATCAGCCACAGAAATTAGTACTCTAATTCCTATGAGTAATTCTTATTTGCATATATG
CATTAAATATTTTTGGTTTTATTTACTTACATAAGATAAAATGGGGTTAGTTGTATCATC
TTAGGTGGCAAGTATACTTTTTATTATTGTCTTTGGAGATTATGTATGGTTAAAGAGTTT
TATACGGGTGTTAAGTTGACAAGTGGCAGTCTGTGAGGGTTAATGCTTATGTCAACTAGA
AATACCTGGGTGAAGATTGGGGAGGAGCTCAACCTACTTCTGCATGTGTGTAAGCCATTT
CTTGATATAAATCTTTCCCTGTATATAAATACACGTATATTCAACCCTGGTTTTGCTTCT
CTAGAGAATCCAACTTAACACACTAACACACAGGTTTAAGGTTGGTCATTTTTTTAGAGC
GTTTATCCCTAGTTATAGTTTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved