Echinops_telfairi Locus Mono:40:SNORD99
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:40:SNORD99
Echinops_telfairi
Mono:40:SNORD99
scaffold_221090
SNORD99
1001..1082
2082
TCCTCCAATCATTGGATTGGAGTGTCCAAAAGGAAGCAAAAGACTCTTGGAAGACTGTT
TCTAAGGGAGACATATGTATGGCCTTTATTGACAAAAGGATAGGATAGGTGAGTGAGGCT
AGGTTCTCTAGAGAAACAACGCAGCGATATTTTATATATAAATGAACCTTTATCAAGAAA
ATTGGCCAAACAGTTGTAACCATGGGAAAGTTCATTACTTTTTCAAGGCTATGGGTCAGA
TGTTATGCTGGAGGCTTTTCATCACTCACATAGTCTTCGAGGCTGATGAACCCAGAATCT
GTAGGTACAGCACAGACTTCAGAGGTAGACGAATCCAAGATTAGCAATGAGGTTTGTGCC
CAAAGAAGTTAGTGAATCCAAGTTGAGCGGGTCAGCTGGCAGCCTGCTGATAGCTCCCAG
GATCACTGGGTAATATGGTAGGATATCGGCTGAAGTAAAAAAAACAACAACAACAACATC
AAAACCTGGATTCAGGTGGAGGATCCATATTCAGCCAAAAGCAAGGAAGCTTTCTGCATC
AACTATTTATATAGGAAGTAACCCACATACCAGAAGAAACCTCCTTGCAAGTGAATCAGG
ACTGTGACCTGAGTAAGGAAGTTGTATCCATCCTAATCTTATAATTACTTGACAGCATAC
ACAATACTCTTTCATAGAGTGGATTACATTAGGTCAGATCATAGAAGACTACAAGGTATC
AAATGCCAAACCACTGAGAATCCTGGCCTGACCAAGTTGATATAAAACCCAACTATCACT
GTAGGCATTTGCACCAGTCATTAGAAATCACGAGTTCTCAGGTCATAATAAAAACAAATA
ACATTGACCTCTCTTGGGCTCTTTCCAGAACTTCGTGTAACCAACTGCCTCAAAAATACC
ATCCAACTAAGCATACATGGAAGGACATCCAGCCTGTGTGATACAGTTAATAAAATCCAA
ACCCACAGGAGGGAACAGCATTAAAGCTTAAATTCTGAACAGCTGTATTCAAGGATGAAA
CCTATTCTGAGTGGACATATATGGATGATAAATACGGATATGGGACTGAGACCAGCTGCT
CGAGAAAAAAAAAATTCTGAACACCTGGTTAGCAGAAGGCTGTGGATGACAGTGGAAGCC
CAAAATCCATTTGCAGGGTCTCCATATGGATTAAGACTTTGGTGAATCCCCTCTGCTCAT
AATTCAGGGATGTGAATAGCCTTGCTGTCAGGCAGAGAGTATTATAAATGTGATTATGGA
AGATAAAATTTGGTAAAAATCTAACTCCTTATCACATGACCTTCCTTTTGACTTATTTTA
AAGTATTTTTATATTTTGTTTTTTTATATTTTCTGATTTCTATTGAAATGAGGTTTTACT
CTATTTTCTTTTGTCATTGTTGTTGGCTTTTTTTGTTTGCTTCCTGTTTGAGTTTTGTAT
AATTTTTTGTATCTGAAATCCAGGAGAGGTAAATCTATATGTTCAGTAAATAGATTAATA
CTTATCTAAGGGTGGGGAGTGGTGATAGGGGAAATGAGGAGCTTTGCAACTGTGAGGACA
AGAAAGAAGAAAATGTCCTGAAATTGATTGTGGTGATGATTACACAAGTCTTTTTTTTTT
TTTAAACATTTTATTAGGGGGCCCATACAACTGGTTATTGCAATCCATACACACATCAAT
TGTGTAAAGCGCATTTGTACATCATTCTCAAAACATTCTCTCCACTCAAACCCCCGACAT
TAGGTCCTCATTTTTCCCCTCCCTCCCCGCTCCCCCCTCCCTCAGAAGCCCTTGATAGTT
CATGATGTGGTATTTTGTCATAGCTTGCCCTGTCCTACGTTTGTATTAAGCCCATTCCCA
GCTGACCTACCCCTCTCCAGGAGACACACGCGGCTCTCTTGAGCATGCCTCAACTGCTCT
GACGGGTCCCTCATGCTGCCGCTACGTATAGAAACATGCCGCCTCGGCGCTCTCCCCACA
CGGTGGCTACTGTCTTGGAGATGCTCACCATTCATTGAGCAGCCAACATGTGTGACAGCA
GGGCTCCGTAGTCTATCCTTAACATAAGGTTATGACTACGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved