Echinops_telfairi Locus Mono:134:SNORA62
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:134:SNORA62
Echinops_telfairi
Mono:134:SNORA62
scaffold_207940
SNORA62
1001..1145
2145
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNAGTTTATTGTGCCAACTGGCCGATAAACACATGTGGGGTTAATTGAA
AGGCAGAGGGATAAATGGCTCAGTGAGCCTCACCTTTCTAGTTCTAGGGTCTCTTGCTTT
CTGATGGTTGGACCAGGGTGCAGGTGCCTTAGCCAGTTCCCTGCTTTAGCTGGCAAGGCT
CACTTCCTGCAAGACATCCCCAAAGAGAAGCCATATGGACTTACTCCAATACAGCCCTGG
GTGCTGGAGCACCTATGTGGAGACCTCTGCCAGCACTGAGATGCTTACAGATTCACTGAC
TCAGCTTTCCTCCTGCAGTCAGCATCATTGTGTCTGTTTTGTGAGATGGAGGAGGACTTT
GTGGATTGGTGTTACACATATGGGTTAATGGGTTAATGTTGGACTTGTGGCCTTGGGCAG
CACTGGGTCGTGATGTTTTCTTGTTGCCACTTACCCTTTATATAAAACTCTCATACTTAA
GTTTCTGTGGATTTGTTTCTCTAAAGTACCCAGACTAACACACCTATGCTTAATCAAGAT
AGTTATTAATACATTACTAGCGTTCACATCTAAAGCCAAATGATGTATTGTTGTAGGGCA
TTAAGAGGGTAGTTGTTGTGAACTTCTGAGTGTCAGAAGTGTGCTACATTAACAGGCAGG
ATTTTTGCTAACACCAGTAGAGCTTGCCTTGATGACTGGAGTTTGATAATACTCAGTGCC
ACATGTAAAGAAAAGAAAGAAAGGAAAAAAAAGAGAGGGTAATTGTTTTGACAGCTAAAA
TATGGTTGGGTTTCGGCAAAAATGAAAACACAGTGAAGGCTAATGATTCTAGCCGATTCC
TTAGCTTTAGATTATATATAAGTAGTTCATGTAAAACTGGTATAATGTGGAAATATCATT
TGAAATATAGACATTATGTCCAGAGGAAGTGGCATAAAATGAATGATATTGATCTTATTT
TTGACAAAAATATAGACCTCTGAACTCTGAGTTCCTGCATCAACACTTTGCTCCCTCTGT
TTACAAATAAACCATGAGACATGACAAAAGGCAACAAGCCGTGTTTCAAGACTTTTCAGG
TTCAAGTTTAGAGTCCTCTATATGTCTGTTGGTTGCTGAGTTAGTCAAATTTCAGGTGTA
ATCCTTCAAAACACATAGGATCCCAGAACAGAATTTCTACCACTCAATTTAACATCCTCT
TATTTCTAAGATATAACAGGGCCAAAATGATATTATCTATGAGCTACATGCCCATTTGAT
GCATTGTTTTGTGAGCAACGTGAGTAATAAAATTAAAAAACATGAAATCAAGTAACTCAT
TCAGTCAAAAATGATTGTATGCGTCGAAGGAAGCCCTGGTCGTGTAGTTGTTATGGGTTT
GGCTATGAATGGAAAGGTGTGCAGTTGGAAACCACCACTGTTTCATGGAAGGAAGACAGG
GCTGTGTCCTCCAGTAAAGATTTACAGTCTCAGAAACCCATAGGGAAGTTCTACTCTGCT
TATACGGTTACTATGAGTCAGAATTGACTCCATAGTGATTTTCTGGTTTTATAACAGTTT
TGTAATTTTGCTGATACAATTTGATTTCGTAGAACAGAAAGACATATAGTAAATAGTATA
TACATTGTGTATACATGTATAACAATTATATTGTCAAACATAAAATCATTGCCTTCACAC
AAAAAAGGAGTCATCACACTGTGTGAGATTAAAAATAAAAATCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved