Echinops_telfairi Locus Mono:311:SNORD78
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:311:SNORD78
Echinops_telfairi
Mono:311:SNORD78
scaffold_257391
SNORD78
1001..1068
2068
TAGTTGAATCTGACTCACAATGACCCTTTAGGACAGAGTAGAATTGTCCTTTTAGTTTT
CCAAGACTGTACATCCGTAATTGAGTAATAAGCCTCATCTTTTTCCCTGCAGAGCAATTC
GTGGGACTTGAGCTTCTGAACATGCAGTTTGTAGCCCAAAGTGAAACCCACCAGGGCTTT
TTGTTTAGCATATTTAAAAAAAAATTAGTGACTCTAAATCTCTCCCCATCTTGAGCACAG
AAGATTGGGAAAAAAAAATCAAAGATTCAAGGGAATAATTAGTTCAAAAGACTAAAGGGC
TACATGAATCCCAGCTTCCACGACTGGACTCTGAGCCCAGAAGAGTTAAATGGTTCTTGG
CTTGCATTGCAAATGGTTTTGAAAGTTATCATGATAGGAATTCCTGAATAGGATGGAGGG
GGAAAATGTGGGGAAAAGTCAAAATAACAATTTGAAAAACAGGCTCAGTAATGGTTTGAT
AGAGATAGATGGAATCCCTGAGATAATGGCCCGGAACAAAACTCATTCCCATGGCTCAAC
TTTCAAATCAAAGGCATAACACAAGGTGAGCAATAACACAAGGGCGGTATTCATTACTTA
GAAGCAATCAACCACAAATGATCAAAAGAGAAACATTTGCTAAGAAATGAAGCTCAGAAG
ACAAGAAGGACCTTCGAGTCTCCCAAACCCAGATACAGCTGCAAGGCAACCCACCTTTGA
AAAAGCTCTCTGTGCCCCATCCTCAGACATCTGGAAAGCACCCTCCCCACAGCCAAGATA
CTGAAAAGGAATGTCAGCTGGGCCAAAGGGCAGTGAAGGAGGAGCCCAACTGGATATCAT
CAAGGTTGTCCGTGAAACCTGCTCTTACAAAAGTGGAGACAAAGCCAAAAAAGGCAGCAG
GAAAGGATGCAGCTTCAGACCAAAAAGTGTGAGCAAAGGGAAAACAGGCTGAAGTGGCTC
ACCAAGAAACCAAAGAAGATTTACCTGGCAAAAATAGAGAAATGTTACAATGATGTTTAA
TGAATGTCTGACCTGAAGAGAGCATGTAGACAAATTTAACACTGAAAAGCCCTGAGATAG
CATTTTAATGGGGAAAATGAATTGGTTTGGGGGATTCAGCTTTTTTATCTTGGAATCCCC
CCCACCCCCACCCCAGGTGCACATTGGAGTACTTTAAAAGATGTGAAGACTCAAGTTTTT
GCTGTAGCGGATGGAAATGAGTTCTCAAAAAAAGGATAGGATCTAAGACTTCATATTTGG
AGAACTAAAGGATTTGTAATCAACCATGCCGGTTCCTGCTGAAAGCTAGCTGGATGAATA
CCCATGGAATAAGATTTTAACATAACTAACACAAATAAATGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCATTTTAGGATTTTTCTACATGCATTAGAATTGTGTATAAATTGT
TCATAATGTCTCTGTAAAGAAGGTCTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved