Echinops_telfairi Locus Mono:239:SNORA65
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:239:SNORA65
Echinops_telfairi
Mono:239:SNORA65
scaffold_283016
SNORA65
1001..1111
2111
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGACCATCCTCTGTTGCTGGTG
CACTCCAGTGGTGACCTGAGAGTAAACCCCCGCTTAGGAAATAGGGTTGTTCTTCATGTG
GATGACGCTGTGCCGAAAGCATGGGGACAGTCAAGGAAAAAAAAAGTGGGGGGCGGTAGA
CCAAATAAGTTTGGGAACCCATTGAATCCTCATGACCCCACACTTACCTGTCCATCTGTC
CGTCTGTGGCCCTCTAAAGGCTGGCACGTTGCTGTGATGCTGAAAGTAATTCAATGGAGC
TTCCAGACTAAGACAGACTAGGAAGAAGAAAGGCCTGGTGCTCTATTTCTGACAACTAGC
CAATGAGGAATCACAAAAGAGCACCGTGCTGGAAGATAGAACCCCACAGTTGGAAACTCA
CCCCCCGCCCCCCCACAGCTTTCCAGTCAATTCCAACTCACAGGGACTCTATAGGACAGA
GCGGAGCTGTAACTTTGGGGTTTCCAAGATGTTGGATCTTTATGGGAGCAAGACAGGCTC
ATTTTTCTCCCAAAGAGATGCTGCAGGGTTTGAACTGCTGACCTGGCAGTTATCCAGCCA
ATGCATAACCCACCAAGCCACCAGGAGCCACGCAACACCCACAGTGGCTGCCACTGTGGG
CTCAGACACATTGAGCATCCTGAAGGTGGCGCTAGACCAGGAAACTTGCCATCCATTAGA
ACCAACACGTGTCCACAAACCATAACACTCACCACCCCCTACCATCATCATCGTGACTCT
TATCTGTGGGTCCTGAGCTCCCCATGAAAGAAATTCTGTTGACTTTTGTGTTGAGCACCA
CCCCCAGTGGACACACAGTAGGTGCTTGTGTAGCCATCCTAAGGAGATGCAATAAGAGCC
CTGGTAGTGGAGTGGGTGGTGCATTGAGCTGCTAACCCCAAGGTCAGCAGTTCGAACCAA
TCGGCTGCTCCTCAGAATAAAAGATGCGGCTTTCCGCTCCCCTACAGATGGAGAACCTTG
GAAACCCTAGGGAGCACTTCTCCTCCAGCCTGGGGAGTTGATTAGCGATGGAGTCGGCTG
GATGGCTATGGGTCTAATGAGATGAACTGCGGGCGTTTGGAGGTAGTGTTGGGGATGGAG
TTAATTCCCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved