Echinops_telfairi Locus Mono:613:SNORA9
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:613:SNORA9
Echinops_telfairi
Mono:613:SNORA9
GeneScaffold_9123
SNORA9
1001..1133
2133
ACATCGTCAATGGTCCATATGGATGGCTCTGTTTGTGCAACGGGCAGCAAGTCACTGTT
CTCTGGCATTTTCCGAATCCTCCCGTCCCGAAGCTCACGCTCTCGTTCCCGCTCGCTCTG
CCTGCGCAAGCGAGTTGTCATAGCAGATGGCACAGAATCTTCATGAGAAGCCAAGTCTTC
TTCTGCAGATGGATAAGTAATTGGAAGCTGGAAAATGTAGTACAAGTAAAATACAGCATT
GCACTTTTCCTTGCATTTCTGAAAAGGGTATTGCATATTGAAGCAAGGTTTCTACAGACC
TGCCTAAGGAGAAGTTCTCTTGCTGCCCCATCAGGGCCACTCGGACGACGGCCGCGATGC
CCAAGATTTTGATTATCAGGCTTACGATTCCAACGACTAAGTGCAAATTTTTTAGAACAG
CTAACATTGTACCTAAAAATTTCAAGTAAGAAAAAAACATTAAATGGTACATGGAACATG
GCATGTAATATTCAATTATGACTTTAAATTGCAACTATGCTACATATTCGGTAGGACTTC
AATAGCTCATAAAAGAAGCCAAAGTGTTCACTGGATTTACTTATGCTAATGGTAAAACCA
TGGCCCCTGTGCATATCATACCTTAACCCAATACTGACCACCCCTACCAAGGTATTGATG
CTTTCTCCAGTAAGTCTCTTTATTTTTAAATAGTTTTATTGACATTGGTTCATACATCAT
ACACTTCCATTGTTCAGTCGTATTAAAGAGTTCTTTAAAAAAGTGAGCTGTACAATCAGT
TCTAGAACATTTTCTTTGGTAGTGGAAATTTTTATGCAAAGTACAGATGCTATCATTTTT
CGTAGCAGCAAAATAATTCTAGGTCCCAGGAGAAATAAGTTTTGTACTAAAGATGTATAC
TCAAAGAGATCATTTCTTAAGTAATCATTTCTGAAAAGATAATGAAAATGGGTAAGGAGA
GGAAAATCTCAAAGAGCTAGTAAAATATTTTTCAAGTATTATTGAAAGTGAAAATATTAT
CTCAAAGTGAAAATTGAAAGCTGAGACCACCTGCTTGCAAGAGCAGCTTTGAAATGGTTT
GAGGCCTTGCTCTACAATATCTACAGAGCAAGGTTATAGAAATTTCAGACATTCAGGAAA
AAGGGGGAAAACAAGAAAGCTGAGACTACCAAGTTACACTAGGGATTAATTGTTCTCACT
ATACAGGAAGTTCAGAAGTACGTAATTCTATAGTTCTTCAAAATTGGCTGAATGGTTATT
TTTATTTTATCAAAATAGATTGCCTAGTGGTTGTGGACAGAGAATCTTATAAAGCATGAT
AAACATTTTAAAGAGTTCTATACCATTGACTGGGTTCCCAACTACTAGAATAGAGTTGAA
GCCAGCTCACAGCAACCAAGTAAGGCAGGGTAGAAAAGCCCCTAAGTTTCATTGGCATAG
AATTCATATATCTTACAATTAAATAACTCAATCACATCAAGAAGAATTGTGCAATCACCA
CCACAATCCATTTTGAAACATTTTCTTCAATCTTATACTCTTCGTTATTAGTTTCCCAAT
CCCCTCAACCCCCACCATACCTAAGGAACCATGAATCCAGTTACTATCTCTGTAGATTTG
TCTATCCTGGGTTTCATATGCAGAAACCTGTTTTTTTAAAAACATCAACTAGCAAACTAA
AACAGAGAAAAACCTCATTTGAAAAGACAGAAAATATCATTAATGAGAACAAATTTAAAT
GAATCATAAGGGAGATCAAATGGCAGGGTGCTAAGTGTTAACCTAACTGCGTCTGCAACA
ATCCAGTTTGCAATGCGTTCTACAGCACAGCAAGGCTATTCACATCCCTGGTCCACGACA
GAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGACATGTAATAAG
AAACCAATTGTTCTTAGATTGGTGCTAATCCCAAATCCACTCATGCATCTATGGTTTTCA
TGTGTCTCTAGTTCACCTTAAAGGCATCATTGTCATTTCATGTTAGAGAAAATTACCAAT
CATCCCCCTGGGGCATCCCTTCCACCGCCATCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved