Echinops_telfairi Locus Mono:312:SNORA68
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:312:SNORA68
Echinops_telfairi
Mono:312:SNORA68
scaffold_225776
SNORA68
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATACCCTTCACTGACAAATTGAA
GATTGGAGAGGAGACCAGTGAGATCCCCTGCCATCTCCACCTACAGGCTGAGTGTCCCCT
GGCACCCACTGTCTTTGGACTTGTGATCTCTGAGTCTTCTGCTTGCACCCAAACCCAAGG
ACTGTGGCTTCTCGTAGCAGCAGTTTAAAGAGTGGTGCGCACAGAAAGTGGGCCTTGTCG
CCTTTGAGGGGCTGTGCAGTGCCCCTCAGAGTGAATGTGAAGGTTCGACAAGCTTGCTAG
TGGGCCCTTGGGCCCATTGGGCGCCATGCAGTGCATGTGGAAGCTTTGTGTTTCTCCTTC
CCTGCAGACCGCGACATGGGTGCTCGACACCGAGCCCGGGCCCATTCCATCCAGATCATG
AAGGTGGAAGAGATTGCCGCCAGCAAGTGCCGCCGGCCTGCGGTCAAGCAATTCCATGTG
AGTGGCTGGGGTTTGGGGGCGTGGTCCTCTAGAACCGGGCGGCAGGGGGACCCTGAAACT
GCAGTCCTGGGGGTGGCCACGCTCCGGTGACCTTAGAAGAAGTTCTGGGCACCTGCCCAG
CCGCTTATCTTGTATCCTCCTCTTTCTCAGGACTCCAAGATCAAGTTCCCACTGCCCCAC
CGAGTCCTGCGACGCCAGCACAAGCCCCGCTTCACCACCAAGCGGCCCAACACCTTCTTC
TAGGCTCACCTCCCACCCGTCTGCCCAATAAACGCCTTGGGGACCGGTACGGGGCCTAGA
GGTTGTTTTCTTTGCCCGCCATACAGAAATCAAAAGAGCGCAGAGTGGGGCATGAGCCCT
GCCCTCTTGTGCACTGCTGGTTTCAGCCCTTGTGTGCCTGCAAACCCCACGTCTGCTCCT
TGAGTGGAGAGGGGCCCAAAGCTGCCGCTCCGTCCTGCCACAGGAATAGCCAAGGTGGGG
GGGGTTCAGGTAGACCTCTCCTGCCTTATTCCATCTCCATGGGGGAGGGGGCTATTCCCC
ACCCCCACCCCACCCCCGCAGTGGAGATCCTGGAGCTTTAATCTTGCCCCAGGACCCCTC
CCATTGTGTCTCCAGGAAACTGCATTAGGCCTGCAAAGGAATGCAGGCACAACCTAATCG
TGCTCTACCTGAGCCAGAGCACGTCCTGCGAGTAGGCCCCCCCTGGAGCTTGGCCACAAC
CCGCCCACAGCTTCCTGTCCTCTTTCCTGAGTGGGTGGGGGGTCAGAGCCTGAAGTGCAC
AACTACATGTGTGTTTTCCGCTGGGGGGTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved