Echinops_telfairi Locus Mono:596:SNORA5
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:596:SNORA5
Echinops_telfairi
Mono:596:SNORA5
GeneScaffold_3387
SNORA5
1001..1116
2116
CTGCAGCTTTGAATGTGAATGTGATTCGTCTTTATTAGCTGCCATGGAGAAGTCCTGAC
GCCCAGGGACCTGGAATACAGCCAAACGACCAATCAGGCACCCCCCTTGTGATCCGCTGC
TGATCTAACTATTGTGATCTGTAAGGTTGTCTGTCACTGGCCGATTTTCAGAAGTAGATC
ACCAGGCCTTTCTTTTTAGGCCATCTTAGACTGGAGGCTCTGCTGAAACCTGTTAAGCAT
AATATTCTCACTGCTAGCGGAGTTGATTCTGACTCGTAGCCACCCTTATAGGACAGTGTG
GAACTGCTCCTGTCCATTTCTGAGACTGTAAATCTTTACAGAAGTAGAAAGCCTCATTTT
TCTCTGAGGAGCAGATGGTGGGGTAGAGCTTCTGACTTCAAGTCGCAGTTCACCAAGTAA
ACCACCCTGCCACCAGGGCGCCTCACTCTGATGGCTTTGAAACATGAAACATGGATGCAA
TGCTAGCCTCTTATTGTTTTAATGCATTGCCTAAGCTTCCAAAGTGATCTTGGGTTCTTC
CCTCTGTAAATCTTTCTAGCCTTTTGGTTTCCAGTGGCGGTTATTAGTTGCTGTTGAGTT
GACTCCAACCCCTGGTGACCCAGCATGTGCAGAGTTGACCTGCTCCCTAGGGGTCATGAC
TTTTTCTGGGTATGTTCTAACCACCAACCTTTTGGCATATGCAGGTCAGCGCTTAAATGT
TCGTCGATCTGCTCCTATAAAGCCTAGATTCTAGAAAACAGTATGGGTCGGTTGGGTTCT
GTCAGTTGGAGTCACTCTCCGTTGACATTATCTCTGTGACAAAGCAGAGGATAGTGGTCA
GGCAGATGTTTTTAGCCCCATTAAAGAGTGAAGCCGAAGGAGCCCTGGTGGCGTGTAATT
GGTACCCACTGAGCTGTGACTGCACAGTCAGTGACTCAAACCCACCCCCTTGCTCCCCAG
GAGAAGATGAAGACTGTCTGCACCCGTAAAGATCGACAATCTGCAGCTATGTCAAATTCA
GTGCTTGCCCCACCCATGGCTGCCACAGAGACACTTTAACTCATGAGCCCTGTTCCTCTC
TGCTGAGCCTCAGAGATAAATTTTGTTACAAACTTTGAGAGAGAGATTTACTGCTCCGGA
AACCCAATGGGGTAGTTCAACTCTGACCTATAGGGTCTTATGACTCAGAATCACCCTGGT
GGCAGTGAGTTTGAGTTTCTGGAAGAAGTGGAGTTAACTGTTTGGTGGCCTCCAACCACA
AAGGAATTAGTTCTTCTATGGCTCACAATGACAGGCGAGGCCCCTCTGAGAAAATGAAGA
CTTGCCTTGGACGGGGTGGGTGGCACTATTTGGATCCAGTTATCTAATGGTGTGCTGAAA
CGTTGGTGCTGCATCAAGAAGTTTAAAATGGCCTGCTGGTGAGGCGGGTGTCTGGAGTTA
TACCTGTATCCAGGAACACTGGGGAGGGTGGGGTGACCTATAAGAGGGTTGGGCTGTGAG
AGCAATTAAAACAGCAGGTGAGTCAGTCCTAAAGACTGATCTTAAACCAAGAACTGAGAC
TCCATGGTGTGAGTACTTTGAATGCAGCTCCCGGAAGAGGAAGACTAAGGATGTAAAGCT
GCTCCAAATGTTTCCGGGTTCAGAGGGTAATAACTCCTGCGTGCTCTCCAGGTGGTGGGT
CTAGCAAAGGGAAGGAACGGACTTACTGAGCATCTGTTTGAGGACTAGGCTCTCTCCGAC
GTGCTTTCACGTCTGTGGGCTCATTTAACCATCCTACAGGGTTGCTATGAGTCGAAACTG
ACTCCATGGCTGTGAGTTCTTTGCCAACAGCCATGTGCAGTTAGTGCAGGCTCCATCTTA
GAGGGAGAGGCACTGAGTCACTTGCTCAGGGTCTCAAAGCAAGAGTTTTCATTTATGACA
AACGCAGGATGCAAACCCAGGCCCCCTGGGCTCCAGAGCCCAGGCTAAGCAGACATCTGA
AACGTTTGTGTGCTAACAGTGGGGATCAATGCTTGTTTTGTCTTCCTCTGTGCTGGACAG
TCAACAGGTGATCAGTAAGCAACTGCTCTGTCTAAACGCCAGCACTGGTTTGCCTCCCCT
GTTTTTCTCTCTATCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved