Echinops_telfairi Locus Mono:319:SNORD29
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:319:SNORD29
Echinops_telfairi
Mono:319:SNORD29
scaffold_254298
SNORD29
1001..1068
1915
ACTCAGGTTTAGGGAAACCCAAGGCTCCCTAAACCGTGACTCCTCTGCCCCACCCTGTC
CCCCCTCTAGTAACCACTAGTAAACTGTGGTCCTTAGTATAGCGCTTGATTATTGATGGT
GCCTGGCACCGTGTTTTACACCCCTGGTCTCGGTGAATGCTCCCCACACCCTGAATGAGC
TGGGTATGGCTCTTAGCCCATTTTACAGAGGGAAACTGAGGTTTGGCGGGGAGTAAGTAA
CGTGGCCCTGGTCACAGCTGGAGGGAAAGCCAAGGCTGTGACCTGAGGCATCTTTGCTGA
ACCGCTCAGCCCCTGCCTCACGCAACTGTGGTGTGGCGTTTTGGGAGAGATCAGGTACAA
ACCCTGGCACACATCCCTCCACCTAGGAGCCCGAAAAGTCAAGGGTCCCAGGACAGAAGA
TGCGATAATCATGATTTCGAATGCAGCGTTCATTTCACGTTTTAAATGCAGTGACCGGTA
TAGAGGGGAACCCAAATTGGCCAGAAATCTCCATGCCCAGATAAGCCCTATTGGCATTGA
GAGGAGGGGAATGAAACTGATGCAAGTCCCCACAGGACAAAAAGCTGCATGGTGACCGGG
GCAGCCCTCCTGCCTGCCTCCTGCCAAGCCCCTGCGCCTCAAAAGTAAATACAAATCCCA
CTGCCGGGCGCCAGGGCCCGCTCAGGGCAGGCCCTTCCGTCACCAGGCAGAACTGCTGCA
CTGGTTGCCTTCACTGTCATTGTGACAACAAACCGCCAAGCCTTTCTTCTGCTGTGCTGT
TGGGTGGCCTGGAACTGCCAACCATTAGGTTAGCAATCGAGTTGCAAGCTGTCTGTGCCA
TTGAGGAACCTTAAAGATGACCCCTTTAAAAAATACCCTGTGATTCTTTTTGGAAATACA
TGAACACCTAGAGGTCCAAACTTCGTGTGTTGGCTGGCACCTGGTAGGTGGCACACTGTG
TGTGCTTCAGAGAGCCTTCCGATTGAGCCCATGCAGTTCTGCCACTTACGAATTAATGAC
AGTGTCTCCTTTGGAGGGTCCCGTTGGTAGAAAGGAGAGGCAACCATGGCCGTCATTGCC
AGTTCCTGTGGGGGTCCTGATGTAATTGTTCGTGTTGACGAGATGGCCCCTACGCATGGT
GACACTGCGCTGTGGTGATAGATGCTGCCTGCCCTGCACCATCTCCATGCTCCCTTGGGA
TCCATAGGATTTTGGGGGGCACAGGCTTTTGGAAGTAGATCTCCAAGCCTTCCTTCCTAG
TTGGTGTTAGTCCGCCTATTCAGCATCACAGCAACACGCAGGCCTCCACTGCCAGATGGC
TGGTGACTGTGCAGCAGGTGCAGTGACGGGAATCTGGGGTTTTGAAGTGTTGTTGTTAGG
TGCCTTTGAATCCGAGTCATCGCAACCCTGTGTGCAATGGAACGACACCTGTGCCCTCCT
CCCAGTAGTTATGTTTGAGCCCCTAGGGACAACCCCTGTGTCAGTCCATTGCTTTGAAGA
TCTTCCTCTTTATCACGGACCCTCGACTTACCAAGTACGCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCTCCTGAACATGTCCAAAGTATGTGAGACAAGTCCGGC
CTACACATTGCCTCTAGGGAGCATTCAGACTGTACCTTCTCCAGGACAGACTTGTGCGTT
CTTTGGGCTGTCCGGAGTACTCTCAGTGTGCGTCACCAACACCATAACTCATACCTATCA
GTTCCTCTTCTGTCGCCCTTACTCAGTGTCCAGCTTTTACATGCACATGAGGCGATTGAA
AATACCATGGCTTGGGTCAGGTGCACCTATTGCTTGGGTCAGGTGCACCATTGCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved