Echinops_telfairi Locus Mono:450:SNORA66
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:450:SNORA66
Echinops_telfairi
Mono:450:SNORA66
scaffold_194913
SNORA66
1001..1131
2131
CTTCAAATGCCCTACTCTATAGTAAATTGACTTGACAGCATATATAGAGAGAGACCAGC
AATTTGAAAAACACTTGTGTATAGTTTTAAGACTGCAGGATCTTGGCAGAGGATAGTGTC
ACAATTCCTAGGTTTAAAATTCTGAGCTACCACTTATTTTGTTAGTCTGTCCCGAATCTC
TCTAAACCTCAATTTCTTTTTGTGTGTGTGTGATGTTAGTTGCTCATGGGCTATATGAAA
GGTTAAAAAAAAATAGGCGCTAACGTCTAAGTTTCAACAAGAATAGCCATCTGGGTTTGA
TTTGGTGATGGGCTGCGTGCCCCGCCACCCCCCAACACACACACACACTCCTTGTTCTTT
TTAAAGCATTTCGAAACTTTGTATTAGATTCTTGTACTTTCCCTTGTGAGTCTACTCTTG
CTATCAGTGTTATAAATGATAATAAATGAGGGAGGGCAGGAATTTTCCTGAACAGTTGTT
TCTTTTCAGGGTTGTTACCTGCCATAAGTTCCCCCCTCATGGTGACCCTATGCACAATAG
TATGAAACACCGCTCAGACTGTGTTGTCCCCATGATTAGTTCCTAGTTGGACCATATTGA
TCCATAGGGTTTTCATTAAATGATTTTCAGAAATTGCTTGCCTGGCCTTTCTTTATCGTC
TGGTTTTATCTGGAAACTGTTCAGCATCATAGCATCCTGCAATTTCTACTGTCAGATGGG
CAGTGGACACACATGAGGTGCACTGGCCTGGATTAGTATTTAGCTATACCGAGCCACCCT
TGCTACCGTTGAGGGATCAATGTTGAAAAAGGCAGGTCATATATATCTTTTTATGTAAAA
GAAAATATTTAAATGCTCTTCTTTTTATAACTAACCTCTCTTCCAGTATTTGTTGATGAA
CTATATAAACCATCTTCTAAGTAGCTCATCCTAGCATCATTATCTTCCAAATTATTGGAG
CATTCATTTATCCTTTATGTGTTGGAGAAAAGGGAAGTAGGTTGCGAACTCAGTCACTAG
CTCTGTATGATGTTACGGAAAGAAGGGGGAACCAGGTTTGCTAAAGTAATTGTGATAGAT
ATGATTTTACCTCAGGAGCTGCTGAGGTGGCCTGTTCAATTCTAATATGGTATTGGGGTT
GGGTGGAGGGGGGGGGGGTCACAGTCAGAACTGCATCTTGAATCTCAGACATGCTTACCA
TTACATAATGAAGAAAACATTGTTTAGTTCAAGCAAAGCTCCTTGCTAAATGATAGAACC
AGTGCACATTTAAAGATGTGTGCCAGTTTTCTCTAGATAATTCTAGTTGATTGCTGTACA
AACAGGGATGTGTGAAACTTTTGGGTAAAAAGGGAACTAGCACTTTATATAGTTTTCAAG
TTTTTGATTAAATGGGTGCCTTATAAGAAAGTTTGTGTTCTGAGGAATAAAGTCCCCTTA
GTGACATGGAGGCAGAGTTTTTTTGGACATAATGCAAATGTTTAAAAGATGCTAATTGTG
TCCAGTTAATAAAAGGCAAGGACTAGCATGTGGACAATTACCCGAAATAATGCCANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTACCATGGCTTCACACAGTCCTG
ATTTTCTGTAGTATTTAAATTAGGGGTCAGGATACAGTGGATTGATCTGACAGGCTGTGG
GTGGTGGGCAGCAGTTTGGAAAACACTTTGAGATTGGGAGGTGGTGTCAGACCTCCTGGA
TTTGAAATTCTCCGCCATTTGCATACTTGCTTTGTTGGTCAGCACAGCAAGATGGTTTCT
ATTTTGATTCCTTTTATAATGTGAGGAAACAGTCATTGATTACTGCTTGATGGAATCACG
GGATCAGTGGGTAATGTAGACAGTATTTCAACCCTGTTACTTGCCCTTATTTCACTGTCC
CAACCACTCCCCCGGCCCCTCACACCACACAGCACATTTACGGGACTTCTCATGTCTTCT
GCTCAAGAGAGCTGCGGAGATCCTTAGGTTCTCTCAACAAGGGGCCCTTGTCCCATTGAC
ATGTTTCAGCATTGGTACTCCCAAGTAAACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved