Echinops_telfairi Locus Mono:271:SNORA27
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:271:SNORA27
Echinops_telfairi
Mono:271:SNORA27
scaffold_225659
SNORA27
1001..1128
2078
TTGAAATGTTGCAGGCATCTTTTCCTTCTGGCCATTTATCTTTTCTTATAATAGAAGAA
ATAGGACTATCAGGCAGTCATAACCAGGTGGCTGACAAGCCAGCAGTTTGTTGATCTTAT
AGGACTGGAGCTGAAACTGTGGGAATTGGCACTGCCTATGTAATGGAGCCCAAATTGTAG
GAGATACAGGGCAATGAGCCTTATTGTAAGCAACTTTCCCATTAAGCCTTTTCCAGAATA
TATAATCCTGAAAAATCTAGTAAGATGTTGCCAAAACGGATGACAGTTTAAAGTCATGTC
ACAGTGATGAAGTGACTCCAATAAGGCGGTGTGCTTTTCAGGGAAGAGAAAGCCAGTAGT
CATTCTAGCCTCTCAGGGACAAACTTGGTTTCTTTATTTTAAGAGACCATGCTCAAGAGA
GGCAGACACAGGCTAACAAAAACTCTAAAAGGCCTCTTGACGGCTCAGACTCTCACAAGA
TAAAAGATTCTTTACCTCTACCCTGTATTTGAATTATGCAATTGGTAAAAGTTACTGAAG
TAAGTACCAGGGCTGCCAGAAGAACAAACAAATGTGTCCTCCTTAGATATAAGAATGGTA
AGACTTCATCTCAGGTACTTTCTTCATGTTACCAGAACAGGCCCCACCCTCGGGAAGCAC
ACCTGGCCTTGTAAAGTGGAAGGGCCTCGAAAAAGAAGACCCCCCCAAAGGCAGATTGAC
ACCAGGGCCAAAACAGTGGTCTCAAACCGAACAATGGTGAGGATAGGAGTGGACCGGGTA
GAGTTTTGCTCCGTTGTGCATAGGATTGACATGAGTCGGAAATGACTTGAAGGCATCTAA
TAACAATTGCACCAACTTATGCAATTTATTTATCAGAGATTGATAGTTGACCCTTCTTGA
AGAAAGACAACATGTGAGATATCGGTTTTGATAGATGGTCAAATAACTGGATACATCTAT
CAGAGATTTTAAATACATATAATGAATATATTCAAGAGACACTCCCCCTACTCATTTTGT
GAATTGGACTTAGGTCTTTACCAGTCATTCAAGTAGGGCAAAAGAAACATTCTTTTAAAG
TCAGGCAAGCTGGGTGTTTGTCCAGAGGAAAGAGGTGGAGGAAACACAATTCAAAAGAGA
AATGCCAAGGGGTCCTTTTCAGAATTTCCCCCTCTGCCCTCCACCTCCAGCCACTCCATG
CCATCAGAGCAATTTTGGCTCATAGAGACCCTGTCGTACCAAGCAGAGGAGAACAACTCC
TCCCTGCGGTTTCTGAGGTTGTAAATCTTCACAGACGCAGACGGTCTCCTCTTCCCCTGG
TAGAGCAGCTGGTGAGATCAAACCATCAACCTTTCAGTTTGCAACCCAATAGTTAGCTTC
CTGCACTACCTCAAGGGAGCATAGAATTATTATGAAAAGAATTATATAACTATTATGTAA
ATGATAGTAAAATAAAAAGTATATAACTGATAATTTAATAAATTAAATTTTCATTTCCGG
GATAACATTAGATGGAACTCCCACAAAAGATGTTATGGAACCTAAGAAGAAGCTAATAGA
CTTAACCCATTTGATTTCACACAACAAATCAGATGGTAGTGGGGGGGAGGGGTGGAAAGA
GGGAGAAAAAGTGTCGGAAGCATTGGGACAGAGTGAAAAAAATCTAATATATGAAGATTA
GATAGGGAATCCCAGAGAGAGAAATTTTGGTCAAAGTATTTGAAGAGAGGCAGTTAAGGA
ATTTTTTTTCTAATTCCCTCAACTCTTTCGCTGCTCCGTGTAGGAGTTTTTGCCTCCTCG
CTCTTCCCTATTAATGATGGTTCTTAATACTTGGGGTTACCCCTTACTTCCCCTGTGTAT
TTATAGTTCTCATCACCAAAGTCCTAGAGTCTCTTTTCCAGTTGACTAAACAATAGTCTA
GAGATACAACATAGTTTGAACACTCTAACCGGTGGTGGCAAAAGTGGGGTAAACCTTTGC
GTACATAGGTTGCCAAGTGAGTAGTAGGGAACGTGACCACGCTGACGCAGAGAGAAAGAT
GAGGGCCTGACCCTGAAAGTCGTGACAGTTTTTGGAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved