Echinops_telfairi Locus Mono:166:SNORA76
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:166:SNORA76
Echinops_telfairi
Mono:166:SNORA76
scaffold_26054
SNORA76
1001..1128
1189
AGGTCAGATCAAATCCTTAAATCCGATATTAGCCCATATGTCTGATGCCAGTCTATAAA
TTCCTCTTCATTGAACCCGCCGCGCCGGCCTGTGGCGCGGGGGTTAAGCTGCAGCGCCAG
AGCAAGTGCTGGCGCATAACTGGGGCCGCCAAGCCTCTGCGGGCGGCCCTTTTAACCGCG
AGCGACACGGCGACCAAAAAAAAAAATTCCTCTTCAGACTCATGCAACACATGTAATGAC
GCTGCGTGCAGGAAGATTACAGGCCATAGGGTGGGAAGTCTGTGGATCCAGTGGCAGTGG
AAGCATCTCAGCTCTGGCATGGGTCTCAACATAGCTCCTCCAGCTCCAGGGCTCAGGCTC
CATCAGCATAGCTCCATGTGGCTTGTTAGCAGGAAGAGGAAGCAAAGTGTGTGTCCTGCC
TCCAGGGAAGAAGACAGGAGTTCCCAGCATCCTCAGGAGAAGGCCATGCCCAGACAGAAG
CCTGATTGGCTATGACTTGATTGACAGGCTAGACTCCACCCTTCGCTCAAGTTGACAGGA
GATTATGTAATTGTCACAGGTAGCAGCTGAGCACTTAACCAATGTGCCTTCAGGGCTCCT
ATATGTACATAATACCTACCTTCCTGAAGTCTGTTCTGGCATATGTTATTGTTAAGTGAC
ATCTAGTCAGTTCTGGCTCATAGACCTTATGTGCAATAGAATGAAATACTTCTGGTCTCT
GCCAGTCTCAGAATTGGTATTATGCTTGAGACCATTGTTGCAAGCACTGTGCTAAACTAA
TGAAGGTCTTCCTTTTTTTTTTTTTTTTTTGGCTGACTCTCAAATATGGTATCTTTTTTC
AGGGACTGATTTCTCCTGATAACATGTCCACAGTATGTGAGGCCAAGTCTGCCCTTCTCT
CTTCTAAGGAACATTCTGGTTGTTCTTCTTCAAAGACACAGACTTGTTTCTTCTTCTGCT
ATTCTATGGTACCTTCAGAATTTTTTTGCCAGCATCATAATTCAAATGCTTAAATTCTTC
TGTAGTCTTTTATTTGTTGTCCAGCTTTCCCATGCATTTGAGGTGATTGAAAATACTGGT
GCTTGCTTCAGGCACAACTTCTCTAACATCATTGTTCTCAGCACTTTAAAAAGAGGTCTT
GTATAGTAGGTTTGCCCAATACAATTTGTTATTTGATTTCTTACCTGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved