Echinops_telfairi Locus Mono:537:SNORD116
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:537:SNORD116
Echinops_telfairi
Mono:537:SNORD116
GeneScaffold_2672
SNORD116
1001..1088
2088
TCAAACCCACCAGCTGCTCCTAGGGAGGAAGCCGAGGCTGTCTGCTCCTGAAAACGTGC
AGAGTCTCAGAAACGTGAGGGAACAGTTCCACTCTGACCAAGGGGTACCTAGCGGGCCGC
TATGTGTGGAATCAACTCAATGGCATAAGTGAGAGTGGGAAGATGGATTTGGGTCACAGC
TCCTTTTCAAAATCCAAAGCAGGTTACGTTTACATTCAGTTATTTTCACCCCTCACCGAT
TTCTTCGTGGTTTCTTCTAGTATCTCTTTTAACTGCTGGTTGAACGACCCTACATAGAAT
CATTAAGTATTGCACTGGATATAAAGATGGTTAAAAATATATAAGGTTGGCATGCATAAG
GTGGGAGCCAGGCATGGCGAGGAGCTGATGGACATGGGTACAGCCAGAAGCAAAATGGGA
AGAACCGTGGGGGCCGAACTGCCCGGAGAGGGGACCCCCGAGAAGTTAAAGGGCAGCTCA
AGGGGGTTGGGGGAGGGCTCAGCATGCAAAGCACACCCAAGGCACTGGAACTAAATACAT
CCTTGGAGGAGGGCTGCAGGTAGCCCTACTACATGCTCCTAGAGCATCCTCAACTTGCCA
TCACTTTCTCCAAGTCTCTGTTGACCTGGGCAAAGGCATCTGGCTCAAGAGTAGTCCGGA
ATGCCAGGGATGGAAGCTCCTTGGGCTTCGGGGTGTTTCCCTTTTCCATGACACTTAAGA
CATGCCAGGCATCCCTTCGGGTTGGCTCAGCTATAAGTCCAATGGGAATAGGTAGCTCCC
TCCTGCAGTGGGGAATGCCCCTGTCCTGGAAGATTTATTGATCCTTTGGGTTGTGACAGT
CAGCACGTGTAGGTCCACAGCCTGATTAGACTGGACCTATTTCAGGGTCCTGGGTGTGGT
TCCAGATGCCTCCCAAGCTGGCGACTGGAGACTGAGGCTGTCCAGCCCTTCAGACTTGGG
GGGGGGGGTATCCTCTAGGAAGTGCCTAGGAGAGGGCACAGATCGATGTTGCCTCCCCCG
TCAGCATTCCTCAGGAAAGCTGAACAAGTGAGTGACAACTCCCTGCCGTCTTGTTCATCA
CACTGAGGTGCAGGCCAGCCCCGCCAAAGTAAGCACTGTAGTCACTACACCCATCAGAAA
AAGCTAGTGACAGAAACATTCGAATGACTCCATTTTTGCTGCCTGCCAAGGCTGCATCAG
AACAATGACCTGACCAGCCTGCTGTAGGGAAGTCCATCTTCTTACAAGTGGTTGCCAATC
TCAGGCCTGATTTTCCTGAGAGGGGGTTGGTGGGGGGGGGGGGGTACCAGAATTATTTTA
AGTGTTGGCTGGCAAGGGCTCGAAGCCAGTGGGTGGTGGGCCACACCTCTGGAGTACTAG
CTGTATCTCACAACACCTTCCACACCAAAGGGCCTGTTATCTCCACCCCGTCTACCCATG
CTCCAAACTCTCCGGGTAATTGACCAAGACTGGGGGGTAGGGGGAGCTGCTGGCACAACT
GAACACCCCCAAATCAGATGAGCGGACTACTGAAGGGCAGGCCCACACCTAAAACCAAAC
TCACTGCCCTGGTGTCGATGATGCCGACTCACAGAGACGCTCTTGACAGAGTAGAACTGC
CCGTGAGTGCCCCAGACTGTTACTGATGGCGGGAGTAGTGAGTCACAGCTTTCTCCAAGG
TGGGGCTGGTGGTTTCGAACTGTTGGTCTTGAGTATCACAGCCCAACCAGTAACCCCTAT
GCCACCAGGGGTCCTTTAAGAATAAACCCAGCCACACCCAAAGTGCCTTGCTCAATACCC
GAGTCTGATTAATCAACAGGAGCACCTGGATCTTCTGGGTCTCTGTGTGGAGAAATGTGA
GACCAAGGCCCGAACTGGCCACCTACAGCCCCCACAGACACCCAGCTTGCTCGGGTCCTT
CTGCCCTAAATCATGTTCTCCAGGGAAAGACGCCGGTGACCGAAAAAGGTCCCAAGGGAA
GCGTTTTAACAACAGTGACAGCAGCCGTGAGGCAAAAGGGCTTGGGTGTGACTTTACCTC
TCCCATGCTAATTTGTCGATAAATGTGGCAATTCTTTCAAGAGGGCGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved