Echinops_telfairi Locus Mono:614:SNORA65
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:614:SNORA65
Echinops_telfairi
Mono:614:SNORA65
GeneScaffold_8334
SNORA65
1001..1128
2128
TGTGCTGCTTATACTTAATGGACCCATCAGTAAACATCCCAACATGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
GGCAGGTTAAGTAAGAAGTTAGCAAAAGATGCTATGTACAAGAATAGGTGGGCTAATAAG
AACAGCCTGAAGAATGAAATAAACATAATCCTAGGCTTTCCCCTCTCCACCCCAAATTCA
GAATAAGTTAGAAAAGTAAAACTAGAATAGCATGACATCCAAGTGAATTCCAAACAAGAA
AGATGAATGAGTACCCAAATCTGCAGGCAATGAGTCAATTCCAACTTATAGTTACTTTAC
AGGACAGAGAAGTGTCCCATAGGGCTTCCATTGCTGTAAGTCTTTACCAAAGCAGACTCA
TATTTCTTCCAGGGGAATGGCTGGTGGGTTCAAACTGTCTACCTTTCAGTTAGCAGCCGA
GAGCTTTAACACTGGGCCATCAGGGCTCCTTAAATGAATGAGTAAAGAAAATTAAACACC
AACATGACAGATGGTCTCAAAACCAGCAGCACCAACTCTTCAATAATGAAACTGCTGGAT
ATCGGCAAGTACTAGAAACTAGTAGAGGAATGTCTTAACAACGAGACTCCCCCACCTGAA
TGGAATCAGTCAAACTATAATAGTACACTGCCAACAATACACTCTTCCACTAAATAAGAC
AAAGAACCAGAAGAGCAATTTCTTGAATTTCCAGAGGTCAAAAGAACATACAAACCAGTA
ATCAACTGGCAAGTACTTATTAAACACAGCCTGCCCAATAAAAACACATTCCTTCCCTCA
AGTAGCTTACAATAAGTTAAGATCAAACAAATGCATGGCAGACAAAAGAAAAGAAAATGA
GACAAACCAAACTAAAGCTAATAACCAATGATGCCCAGCCACCCACCACTGCACCTGACC
ATTCTCTGTTGCTGGTGCAATCCAATGGTGAGCTGAGAGTAAACCCCAGCTTAGGAAACA
GGGTTGTTCTTCATGTGGATGACTCTGTGCTGAAAGCATGGGGACAGTCAAGAAAAAAAC
AAAACAAATGAACAAAGATACAGTAATACATATGCTCATCATATTATCCATCCAACTCAC
AGTGGAGTAGATTCCGACTCCTAGTAATCCTGCAGAGTGGAACTGACGAGGAGGGTTTCC
GAGGCTGTAAATCTTTATGGAATGAGCCTCGTCTTTCTCCCATGTGTGGTTCTTTAGTAG
CCCATACTTAACTCATTGCTTCACCAGAGCTCCTTTGCTCATGCTACTCCAAAACGAAAG
CAAACTACTGCCTTGGAACCACTTGGTAGAACTAACTGTCCCAGTGAGTTTCTGAGACTG
TAACTCTTTACAGATGTAAAAAGCCCCAGTCTTTCAGCTGGTGGTTTCAAAAGGCTGACT
TTGAGGTTGGTAGCCCAACACATTACCACTATTCCACCTGGGCTCCTTGCTTGAGCCACT
AGTTGAGTGTAACACAATACATCTGATAATGTTGCAAGAGTCTATACAGAACCTTTGACC
CAGCATGCCTCGTCTACATATCCAAAGTATTTCAATGATTCATATACAAGGTTATTCTGT
GTAGAAAAATGTATATTCATAAAACATTAGAAGCACCGCTAGCATTTGAAAATAGTAAAG
ATTTTAAATGAATTATATGGTGAAATGTTCATCAATTAGTATGGAGCCCTGGTGGTGTAG
TGGTTACAAGGTGAGATGTATTCAGTGTATTCAGCTGTATTCCTGTAAACATTTATAGTC
CTGGAAACCAAGAGTTAGAGAAAATATATGTATGCACACATAATAAAGTGGGGATACGGC
TATCAAAAAGTATAGCATCTGGGGTCTTAAAGGCTTGAAGGTAATCAAGCGGCCATCAAG
CTCAGAAGCAACAAAGCCCACATGGAAGAAGCACACCAGCCTATCCAACCACGAGGTGTC
GAAGGGATCAGGTGTAAGGCATCATCAGAACAAAAAATCTTACCATAGTGAATGATGGGG
GGAGTGCGGAGTGGAGATCCAAAGCCCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved