Echinops_telfairi Locus Mono:153:SNORA9
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:153:SNORA9
Echinops_telfairi
Mono:153:SNORA9
scaffold_272034
SNORA9
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGAGTGCCCTCAAGAGTGGGTAGAGGTTCAAACCTCGCAAAGCGGTTTGAGCTAGAGGAT
CAGGAAGAGGCCCAGAATTGAACTGACTGTGTGAGCCTGCTGGGATGGCAGTGAGTGAGA
TAGACAGCCTGTAAAAGTGGGAGGGAACCCTTGACTTCTTCATAGCAGTTCTGTAAGATG
CCTGGGAGGAGGATGCTATAAAAGCCTTAGCGCTGACTTCCCTGAATTTGGGTCTATTTT
ACCATTATTTCTCAGGGAGAATCCTTATTTAATCTACTTTACATATCTATACCCTACTTG
GGGTGTGCTTTTGAATTATAAGCTACATATTGAGAAGGGTATGGAAGGAAAAGTCTGCTT
AGTAGAATCATATGATGGTGTGGGTATTTCTGTGGCCAAATCAGTTCAAGAAACCAGAAT
TATAGTACTTTTGAGAACAATGTTTAGCTAGTACTGTCTGGTCCAAATGAAAGGCCACCT
TTTCCAAATGCCTTCCAAGTGGAAAGCATCTTCCCTACTGAACATCACAGCACTTCATTT
GGAATCCTTTCCTACTTTTACACTTCCTACTTTCAGAGCTGTATTTTGCCGCAGGCTCTG
GGAGAAAGCCCAAACATGCCTAACTGCATGCCATGATCCATCCTCCTCCACGCTTCTTGT
AAGGGCTGGTGCTCAAGAAGAGTGACTTGAGTGAGCAAGGGTTGCTTGCCTCCAGCCTGC
TTGAATCTGGAGTGGTTCTGGGCATTCCTACAGTGCTTTGCAAGATCAGCTTTGAAATGG
TCTGAGGCCTTACTTGATACTGTCTATAGAACAAGGTTATAGAAATTTCACACAGTTATT
TGTGCCTGGATCTTTTGTACTAGACATCTACAGATCTGTACTCTCCAATGTATAGCAACT
TGCTATATATAATTAAACATTTAAGTTCAGTTTCCACTTGTGTTAGATGTATTCCAAGAG
CTCAGTAACCCTGAGGGCACAAAGGTTAAGCATTTGGCTGCTAACCAAAAGGTTGGTGGT
TTGAACCCACCCAATCGTTGTGTGGGGAAAATGCTAGGTGATCGGCTTCTGTAAAGATTA
AGTGAAGGAACCTGTATGGGACAGTTCTGCTCTGTCACACGCATGGACTCATAGATATAC
GCAGCGGGAGCCAGCAACAATATACCCAGCACCTTTCCTCTAACACACTCTTCAAGCAGA
TGCTTCTGGATTTCCTTTATATCTCCCAGAGGAATTGGCGCGTGGGCGCTGATGCAAAAA
TGTTGATCCTCTGACGACTTCTCTTGCTGTGAATAATCGACTGCATTTGTTTCCGCCTTA
AGGTCTTGTGTCTTCCACCAATATTCATAAGCAGGCAGACTACCTTGTTAGCTTGCAAGA
AGGCGCTCACACCCGTCACATTTCTTGACAGCCATGTCCTTTCAGGCTAAAGTGTATCTC
CCTGAGGCAACCTATGACTTGGATCTGCCCTGTGTTTCAGCAGCAACATCGCAGAAAGCT
AGAACTAGAAGTTACCTGGCAAGCCATCCATTCAGTGACTGCCAGTCCCTTCTATGGAAT
CCAAATGGTGGTAAGTATGCAGAAAGTCTGGTATGGTAAGTTATGTTTTTTCATATACTA
ATTTTGTCATGACAATATATGCTTTTTCATATATTAATTTTCCATGAGTGTACCAGGACC
CCAATAAAGTTTTTAAAACTCCGATTTATTCTGACCTTCCCATTTATAAGTCAGGTGAAA
TGAGTCCCAGAAAGATTAGTTACCTTCAGCCATGAGACTGTTTCATGTTTAATGGGTAAA
AAGTCTAGATTAAAGCCAGTCCACCTTATTTGTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved