Echinops_telfairi Locus Mono:205:SNORA72
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:205:SNORA72
Echinops_telfairi
Mono:205:SNORA72
scaffold_319334
SNORA72
1001..1131
2131
AAACCTGCCATAATAAAAGTATATGACAAGGACTGTAACATGATGTGATTCAAGTCCCA
TTCCCATCAAACACTGGCTATTTAAGTAGTTGAAGTCACTTACTTTTTTATTGTTTCTCA
GCTAGGAAACTGGTTTATGAGGCTGTTTTTACAGAACTGTTGTTCTGTAATAATTTTAAA
ATATCCAGATTAGTACAGTCATCTAGATATGACCATTGTTACACAGGGTAACAACTAGCC
ACTAGAGCTTATTGAGAAATTGTGAGTGGTTGGTTTATACAGAGATGCATTTTAAGTGTA
AAACACATGTTAGATCTCAAATAATATGGAAAAAAAAGAATGTCCCGTATTTCATTATAA
GCATTTATATCAAAAACATGCTTAATTATACTATGTTGGGAAACATATCATTACCAATTC
CATTTCAAGTAATTAATTTGCAATTTTTCAAACCATGGACAGATAACCTAAAAATTTAGG
TAGATCTGTAGATTACATTACATTGCAGTGTGTAGCATTTTTTAAAATTCCTGATACATG
CTAGGTGCTTAAGTTGAACATCAATAATTTGGGCAGTAGTGTCATATATTTCCATCTTTA
ATTTCAGATCCTTACTCCGAGTTCTGGGAGTTCTTCAGAAGCTCAGTGGAGATGGGCCAT
GGAGAGACTTGATTCTCTTGAAAAAGTTTAGAAACAAAGGAGCTTTGATGGGCAGAATCG
TCTGCATCTCTGCAAGGGACTCTATTTGACACTGTCCAGGGAATAATGTGGAGGAAGAAG
GAAGAATAAAAGATCAAGACATAAGGATTTCACTTAAATTTCAAATGAATCCCCTAGTGA
AGTTTATCTCTCAGATTTACTTTACAGATTTGTTAGAAAAGACAAATATATTTAATACTC
TGATAGGCACTGAAATAACTTGAAGCATGTCAACACTTTTTGGTGTATACTTGCATGTTT
TCCAAGAAAACACTCTTTGAGCATTATAAAAAAGGAATGATATGCGAATATTCTCACTGT
CCTGGTTTTGTGGTAGCCAGGGCAGGCTAAACATTCGCTAGATTAAGACCATGCATGTGT
CCCCAGGCTGGGTTCTTTCCCTGAGCCTGGTTTATAAATGCTGGTGATTAGAGAAAAAAA
GGGAATAATATTTGGTATGAACATTGATAACTGACTTTAAATCCAAGTACAATTACTGAT
TCAAAGCAATCTAAATATGAGTTTCATCTACCTACTTAGACCTACCTGATTGTTCTTTTT
ATCATCTACAAGACTGCGGAAGCATCTTTTCTATATGCCTCTCACGTTTCACTATTTTTA
GCTTCGAGTTACAGTAAGCAACCCCCTTTCAGTTAAGAATTGGTATGCAGTTCATCTTGT
ATCCAACACTAAATTTAATGCAAGGTCATAGGAATTAGGCACATTCACACACACAAAAAT
TAGATAAGTGCATGAATTATTTAATACCAACTTAAAATAAACTTTCCATCATTGAATAAT
CTAATTTATTAATAATCCTGAGTCTGCTAACTAAAATGGAAATCTTACCAATTCCATGTA
AGTCTGAAGTATTCATGATTTGTCAATATTAACCAGATAAATAATCCAAAATGCCCCCTC
TGTTTTACTTGATGCCTGAGAATCAAGAGCTGAAAATGTAATTACTCATTTAAATCATGA
TTTTTTTTTGCCGTTGTCAGTTTGTTTTGCTTTCCTTCTCCACCCCCTGACCTACCTAAT
GAAGTTCACCTACACCTCATGTAGAGTTGTAAGAGCATGCTACTTAAAAAAAAAAAAATT
AACCCAACTGGGTTGTCCCTATCCAATATAACCTTATATATTGCCTAATCTTCAGAAGAC
ATTTCATTAGGTCATATTTTTGATGTGCATTGTGCAAGCACAGTATTTGTACTGTAGTAT
TCATGCTAAAGTACATATTCACGTGACAGCCCATACGATCCTTGAAACAGCCATTACAGT
CTGTCAAATAAATAATGCACATTTTAAAGATGGTCTTTATGTCGGATGACTCTCCTGCAT
TTTCATGAGGCAGATTTTTCTTTTATTCTTTAGGAAAGAAAAGCACACAAAGGAAATGAA
CATGCAGGAAAAGATGTTAAGGTGGCAGGGAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved