Echinops_telfairi Locus Mono:466:SNORA32
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:466:SNORA32
Echinops_telfairi
Mono:466:SNORA32
scaffold_96756
SNORA32
1001..1117
1491
AGCTAGCCATTAAAAATCTTATGGAGTATAGATTTACTTTGAAACCACATATTGTCACC
ATGTGGAAGGAAATGGTGGGCCAGATGATTGCTATTTATCAAATTATTATCTAATTGTGA
TACAAGGAGCGCATTGGTAGCGCAATCCTTCATGCCATGAAATCACAAGGGAGTTTCAAA
AAAGATCATGGAAAAATGGAATAAAGATAATGTAATTTATCCATGATCCTTTTGAAGCCT
CTGCTTATCTGTTTCTAATAGATAATGCTAAACAATGTGGTATTATTATGCTAAACAGAA
TGATAGAATAAATATGTTATAATTCCTCAAATATTATACATCTTAAAAAATCTTTAGGAA
ACCTATTCATTTTCCATGAAAATTCAGAAACATTAAGAAATTTGTGATTTGCTGTGGACA
TGACTATAGACAATTTCCCAGGAGGTTTTTGTCTTTGCTACCTTGCTAGCATATAACCGA
TTGGGGACATTGAAAAAAAAAAAAAAGAAATTTATATAGAGTATCTCTCTTGAAGATCTA
TTAAAGTTGATATTAATTTTATTCTCTAGCTATGGTAAAGAGACCAGTTAGATTACAGTA
TATCTGTACAATTCACATAGAAACTTATGAGAGCTAAAAATTAACAGAATGACTTTATTT
TTGGTTCCTGCAAATTTTACATATTCAACAAGGCGGTTTCTCATGTTATAATTAAAAATT
CAACCTCATTGTATGGTTTTGAGTTTTCCTTTCTTTGAAAGATTGCCAGGTTACATAGGG
TTCTGGCATGTGTGTGCATGCATGCATGTGAGTCTGCTTAGTTTTTGATGTCCCTGAGCA
TTATAATGGTTAACATGGATAGGTGTTCATAGAAATTCTGGAAGTTTGTGTCTACTCGGA
GTCTGCAGAAAACCTGGGTGATGCACTTCGAGAAACCAGTCACTGAAACCTGTCTGCAAC
ATCCCTGTGCTCTGACACATATGGAGTCTCAGGAGTTGGTGTGAGTTTGATGGCATCTGT
TTGGCCTGGTTCATTTCTAGTGGGGAGGGGAGGAGAGAATCCTGGCTTCATTTGCTACCC
TCAAGGCTGGCAGTTCAACTCCACCAGCAGATCTGTAAGAGAAAAACGAGGCTGGTTGTT
CCTGTGTAGATTTTGAATCTCAGACACCTATAGAGGAACACTGTGAGTCAGAATTGACTT
TGTGGCAGTGAGTTTGCTTTTGGGGGTCAAGGACAATGAAGCTTTGTAGGTGGCAAAAAC
AGCTTGAAGTAGACAGTTCCACTGAGGGTTGACGGGTTAAATTCAGCCTGCGTGACTGTG
GAAGACAGGACTGGAGACCTTGTTCCACAATTGATACTCCAGAAACACTATGGAACTGTT
CCACTCTATAACACACGAAGTTGCCATGAGATGGAATTAACACCAAGGCCCCTAACCAAA
GGGAAAATTAAACACGATGAATGCATATTCATGTCTGTGTGTGCACATCGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved