Echinops_telfairi Locus Poly:9:SNORD81
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:9:SNORD81
Echinops_telfairi
Poly:9:SNORD81
GeneScaffold_2637
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD47, SNORD81
1001..1077, 1410..1478, 1642..1722, 1933..1998, 2268..2327, 2519..2583, 3215..3291, 3434..3507
4507
AGGGGTGCCAGGCCAGGGAGCAAGCGCACAGGTGAGGGTGAAAGACCCACAGGGGGCGG
CGCCCCGGGACCCGGTAGAGGCGGCGGGCGTAGGCGGGCGGGGAGCTGGCCCAGAGGTGG
GTGTGTGCATCTGGGTGTGTCCGGGCGGCGGAGGGGGGAGGGCCGCCCATCCCCAGGTCC
TGAGGGAGGGGCCCCGCGAGGGGGCGGGTCCCGCAGCTCCGGCCGGCCCGGGGCCAAGGA
GGTGGAAGGTCGCCCGGTGGCCAGGGTGGGCAAAAGGAAGTGGCTGGGTGCCCCAGGAAC
GAGCTACCGCCTCAACGGGGTAAACTGGTCCCCGTGCAGGGCAGCGGGACCGGTGTGCGG
GGCCTCCTCCCAGGCGAGGAGCAGCACCTACCTCCGGGAGTGGAAATGGGCCGGAATGGG
CCGAAACACCGTCCCGGAAGTGAAACCCCCCACCTCCTCCCCCGGAGCGGGCGACGTGCC
GGAAGGAAATCACTCACCCTTACACCGCCCCCTTCCCCCTCCCCCCGCGCTTTCCGTCCC
TCGCGCCCCCTCCCCTTTCTTCCTCACTACTCGGAAGGAGGGCGGGAGTCCCGGGTCCAG
CGGGCACTTGTGGTTCACGCCCACAAAGGGGAGTGGGGCGGGGCCAAGGGCCTAGGGGCG
GGGAAGAAGGAGGGGCTGGGGGAGGAGACGGGGAGGAGTTGGCTTTGACGCTGGAGAGGA
GCGTGCGTCGTGACGTCAGGGAAAGCTCATATATATACAGGCATTTGGGCGCCATCTCGT
TCTTTCCGGTCTTCGGTTTCTCGTCTCCTAGGTAAGCGCTTCTTCTTTGGGTGCTTTCTT
AACGTTTAGTCCAGGTCTTTGGCGACTCAGGCCAGTTGCTCATTTTCCTTGCTGGCTCTG
CAAGGCTTGGATGGTGTGGGATTGCGCGTTCCGTACGCGTGAGATCCAAACGTAGGTACG
GTGGGCTTTTCGGGTATGTGGCGGGAGGCTTTTCTGCCCGCGTGGCGTGCCTGTGATGAA
GCTCGTGTTGGTAGGGACATCTGAGACTTGATGAATGCCAACTGCTCTGATGGCGCATGC
ATGCGGGCCCGCCGAGTTGGCATCTGGCCTCCGCCGCTTGCGCTAGGTTAAGGCGGATGG
TTAGGGGGGAGGGGAGCCCACGTGGTTCTCTTAATGGTTCTTGTCTGCATTGTACCAGTA
TTGGGGGCAGTAGTTCTTTGGTTTGGTGCACTGCACTCTACTAATAAATAAACTTTATCG
TGGAATCTCTGAATGAGACAAACTGCGTATAATTTGAAAATCTTATTTTCTTCAGGAACT
GGAATAAACATGAATACAATGTGGCGGATACAGGCTCGAATCCAGGTGAGAAAATTCGAA
AGGGAGAAATCTTACTTCCTTCAGCTTTTAAGCCTGTGATGGTATTCAGAGTAGTGGACT
GAAGGGATTTCTGAAAGAAAAAAAAGTAATGCTGAGGCTTTATACTTGACGATTGATGTG
TCACTTTGCTGCCCTGGATGCATCATCTTATGCTTCAATTTTGCTTTGTTCCAGATAGCT
GCAGAAGAAGGATGAGGACAGTTGCGGGGTGAGTTATGGAAATGCCAGTATTAAGAAATT
CCTTGGTAGAAACCAGTGAGTGTGCCACCATGATGAAATTTATTTGCTACTCTTGACTAT
GAGGGTGACGAGAATTCTTACCACCATTGTTCTAACTGAGGCACCGAAAGTAGTGTTGGG
GGTATGTACAAATAGCACCTCGGTTAAGATGAATTTGTTCTTCACAGGTCTTGAAAATAG
AGCTGAAATTTCGGCCATGGGCACAGCAGGTGAGATGTTCACTCGATTTTTTTGTTTCAA
TTGGGGTGAGGGGGTGTACCCAAATCAAAGTTGGTGCATGTGGAAGGTTATACGTGCAGT
GTTGGTAAAGGAGATACTGTGATGGCTTGCATAGTTCAACAGATTGCATGAAGAGATGTA
CCACTTATCTGATGTATCTTTTACCAGTAAATTATTCAGTGTTACTAGAGTAAGAAACTA
CCAATGTTAATTGAATTCTTACTCTGTCTTTTGTAGACACTAGAAGGAAATCACTGGAAG
TCAAAGTGGTAAGTAAAGTTAGATTGAAGTAAATCTGAGTAACTGGGCCAAACTGACACC
CAAATGGTGTTTGGGGTGTAGGAATATCACATCTGATGGACGTGTCGTAGTTTAAAGTTA
CATGTCACGTAGTTGCCCTGTTACTGTTCAGTGGCTGGTAAATGCATGCCTGTGTGATGA
TAAGCAAATGCGGACTAAAGATGAAGGTCTTAATTAGCTCTAGCTGATGCCAGGCATTTG
GTACATTTGGAGAGAAAAGCAAACTCGAGCCTTTTCTTAAAACTATTGTCTGTTTCTTAG
ATGGACTGAGTCTGACATGTCTGGAACCACTTAATTGGTGAGTATAGTCCAGGCTCAAGA
GCAATTAGCTGTGGATTAGCTTTAATATGAGTGCTAGCCTTTTCCTTTAAGAACAGGGTT
TACAATGATGTTTAACGAATGTCTGACCTGAAGAGAGCATGTAGACAAATTTAACACTGA
AAAGCCCTGAGATAGCATTTTAATGGGGAAAATGAATTGGTTTGGGGGATTCAGTTATTT
ATCTTGGAACTTTTTCCCCCCAGGTGCACATTGGAGTACTTTAAAAGGTATGTTGCTCAA
CTATATTAACATGTTTTCTAAGAATGCTGTTGATGATGACTATAAATGATGGGAATCTCT
CTGAAAGAAAATGAAGACTTAATATTGGAAACTGAAACAGTATCTAAAATGCTTAAAAAG
GAAAAGGAAACGCTCCTCACTGTTACTAACTTGACTGTTTTTCCAGATGTGAAGACTCAG
GTTTTTGCTGTCGCGGATGGAAATGAGTTCTCAAAAAAAAAGGTAGTTTCTTACTTATTG
TGAGCTACAGCCAATACAATGATGATAACATAGTTCAGCAGACATAACAGTGGTGAATAA
CACTTAGTCTTTCGCTCCTATCTGATGTATCTGGCTGAAATAATCTTTAACCATATTTCT
AGAGAAATGTTTAGAGCTTTGAATAATTATTTCCTCAAATGTCTTATTTGCTTTAATTTT
AGGATAGGATCTAAGACTTCATATTTGGAGAACTAAAGGTTAGTTAAAATTTCTATATCA
ATATTTATGTTGATGGCTTATTTGTACCTCAAAGTAACCAATGATGTAATGATTCTGCCA
AATGAAACATCATGATATTACTCAATAACCGTTCCATTTTAATTCTGAGGTTACTTTACT
AATGATGTCAGCACCCTAAAACTTTGTCCCAGAAATAAAATATCTTTTTTGCCTCCACCC
CCCTAGGATTTGTAATCAACCATGCTGGTTCCTGCTGAAAGGTGAGTCTTAAAAATATCA
CCTCTCTTCCAGCACAGAATACATGATGATCCACCCCAACTTGAACTCTCTCACTGATAA
CTTGATGATAATGGGATCTGATATTCTGTGTATACCAAACCAGCTTTTAAGGTAAAATCT
GGATGTGTGACTAAACCATGAATCTTCTGTTTTGCAGCTAGCTGGATGGATACCCATGGA
ATAAGATTTTAACATACAGTAACAAATAAATCTTCATAAAACATCTGGAACTGTGTTCTC
TTTAATTTGCAAAGGATGATGACAGTGCAAAGAGCAATACTGTAAATCATCTCAAAGGCC
ATCACTCTTTATATTTATCCTAATGGCTGCCTCCTTTCAGTGGCTGGTAGTCTGAACCAT
GATAGCAGCTCAATGGTGAAATCACAGGTAATACTTTGAGGTATACAAGTGAGGGGGGAG
AGGTGTCATTGAACTTAAAATTCTAAAACAACATTTTGTATTGCGGTATTTGTAAGGTGC
TATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAATTCAT
AGTGGCCCTAAAGGGCAAGGTTAAAACTTCTGATCTCAAGATGAAAGCTGGTCCCTGCCA
TAGGATGTCAGCAGAAATTTTTACTTGTGGCTGTGGTTCATTTTAGCATGGCCATCTAGT
CTTGGCTCTGAACACCTCTGGCTTCAATCTGGAGGATTCTTTTGGAGTCAATTGTGTTTA
ATTTTTCTTTTAAATCATGGGAGCAGAAAGATTAGTTTTTCCCCCATGGAGTGGCTGGTA
GGTTTGAACTGTTCTGTGGTTAGCAGCCCAGCAACCTGTGATGCCACCAGATCTGCTATT
GGCAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved