Echinops_telfairi Locus Mono:404:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:404:SNORA61
Echinops_telfairi
Mono:404:SNORA61
scaffold_174164
SNORA61
1001..1120
1205
CCTGCGATCCATTCCCCCTTTCTACACCCCCCTTTAAAAAACAATTTCAGGTACAATCT
TTCTGCTTAAAAAACAATGTATTCCTACCCTCCAGATTCCTTGCCCCTCAGATCAAAATA
CTGGTCTGAGAGGATAAAAAGGAGGGAAAGTAAAACTGAAGTGGACTTGGAGTCTCTAAT
AACCTACAAGTTCATTTCAAAATAATAAATAAATAAAATCTATTTCTTACCGAAATTTCC
AAAAATAAAACAAAGCAACTTATTACGTAAGCCTTCATTAGAGTACTAAATACTCAGGAT
GTAACAGGCCTCCTGCAGACCTCTCTTGTGGCTGTACAGGCTGCTAATCAGATGAATGTA
GATAGAAGGCTGGGAGAGAAGGCATTTTCAGCATTGTACCATCCAAGCAAGTGTTCAATG
TCCAACCAACCAGATAAGTTCATACAAGATAAGAAATAGATGGGAAAAAGTTATTTGTGG
TTCAACTTGGTATGCTTTTTTTGGCTTAGCAAAGAGATAACTTCATCTTTATACCCTGCT
CAATTCTCTATGGTGACTTAAAAAATAGTACCGAAATTTTAAAATGAGTATATGATATTC
CCAGTGGCCTAAAATGGATAATTAAAAGAACCCCAAAGTGAAATATAAGACAATTCACTG
TTTTCAGTGTAACTTGGATTTTTTTTGAAAGACAGATACTATATTTTCCATGATTATAAA
ATAGAAGTATATCCATTGCTGAGATTTTTGAAAATATGTGAAATACAAGTCAATAGTAAC
TACAAACTCACAGACACTCACTATTGTCATTTGGGAACATTTCCTTTGTCCTTTTTTCTA
CAGACGGTCCAGCTTCAGGACTGTGTGACCTGTGCAGTCGCCCAGTCACGTTCAGAAAGG
CCCCAGGCTTGTTTTAATGCTCTGCTATTGCCATCTTGAAATTCTTAATAATTTTTAAAC
AAGAAGCCATGTACACTGAGCCCTGCAAATTATATCACCAGACCTATCGCCAGATGTCCA
TGCAGCCATATCTACTAATATATATTTATATATATAAACAGTACTATCTTTATGTAAATG
ATATGTAACTATATAGTTTTATGTCATATTTTACTGCCTACTATTTCATTCAGTGTCAAT
AAATGTTATTTTTATGTTTGCATAGTATTTTATCATATGGAAAAGTAATATCCAGTATTT
AAATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved