Echinops_telfairi Locus Poly:0:SNORA33
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:0:SNORA33
Echinops_telfairi
Poly:0:SNORA33
scaffold_302598
SNORA33, SNORA33
1001..1132, 1749..1880
2880
CTAAGTAACATGACTTTAGAAATTCGCCCTCAGTTCAAGCCAGTCTGAGGAGCCTGAAT
AATAATATATTTTTTTAAAGAACCATAATGGAACACGCTTTCTGTCTCTGACCCAGAATT
AATCATAGTGAAAAGACATCTCGTGAAAGGAGGGTCGTTAATTAGCTCTAATGGATCTTG
CTAGGTGGAGTCTGAGTTATTGGGAAGGCAGCAAACACAGGGAGCGGGGAGACTCTCCGT
TCTCTGGCTAGCTCCATGGGATGCTGTGATGTAAGGGGAGGAGCTTTGCTTCCAGAGGGC
AAGCATCCCGGATGAGGTTGCAGAAGGGGGTGGAAAGTTCCATTTGTTGCACAGATGCTG
GCAGCCCACCAGCTCTGAAGGTCTTCCAGGAAAGAAGTAGAGGTGGTTGTTTCCAGTGCA
AAGGGCCTGGCTCTTCTCTTCCTTTCTCTGCAGCTGCTGCGTCACGGGCTTCATTACATG
CTCAGATGAGACTACAGAGCTAGGCTGTCCTGTGGGGTTGCTATGAGTCAGGACTGACTT
GATCCCAGAGAGCGGTCTCATAGCTCTTGTTCTCCCCAGTGAGGCCAATGTTTCTATANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCCCCCAACCCCCACCCC
ACCCCCACCCCCGTGTGCTCTACGAACGCATTCCCTCCTATTTTCCTGCTCCATCCCTCC
CTCCCTCCAAGGTGCACTGGCTTCCTTGATGCCCCAGCAACCCCTGCACAGGCTTCTGGT
CCCAGGCCCTTTGCGTGGCTGCTCTGTCTCTAGCAGAAATCCGATACTCCCGAAAGCCTG
GTTTTCTTTTTCCCAGATTTTAAGACTTTGATCAAATGTGACCTTAATAAGCCCCGTATT
ATTGACCACCCTGTGTAAGCCTCCCCATCCCTGTTACACAGAGGCTTGAAGAGTTCAGGG
GAATTGATTGTGTTTCTGCAGAAATTTAGAAAAAGCTGGCAGTAACAGTAAAGCCATGTT
ACGAGCCTTAAGGATAATTGAGATCATTAAGGTCCCTGAAAATGGCTACATTTTAAAAAA
TTTTTTTAAAAAAGTTCATGGGAAAATGGAAGTAAAAGATAATGGAATTTTTCTATGAAC
TTTTTTGAAGCCTCCTTGTCCTATTTTTTTCTTTCTCCCCACCTATCGTATATTATATTT
CCCTTATCTATTATATTTAGTCACAGTGAATCTCTTCCCTTTGTTGAGTGTTGGAGTGTT
CTTTCTGTTTTGTTTTGTTTTTAACTGTGTTGTTGGCATATAATTCACATATTCAATAGT
TTAATCACATCGAGAAGAATTGTACAATCATCACCCCAATCAGCTTTAGGACATTTTCTT
CATTCTTGCGCTCATCATTGTTAGCTCCTATTTCTTCTCTTATTAGAATAGAAATTCCTC
AAAATTAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTCTCTA
GCAGAAATCCGATACTCCCGAAAGCCTGGTTTTCTTTTTCCCAGATTTTAAGACTTTGAT
CAAATGTGACCTTAATAAGCCCCGTATTATTGACCACCCTGTGTAAGCCTCCCCATCCCT
GTTACACAGAGGCTTGAAGAGTTCAGGGGAATTGATTGTGTTTCTGCAGAAATTTAGAAA
AAGCTGGCAGTAACAGTAAAGCCATGTTACGAGCCTTAAGGATAATTGAGATCATTAAGG
TCCCTGAAAATGGCTACATTTAAAAAAATTTTTTTAAAAAAGTTCATGGGAAAATGGAAG
TAAAAGATAATGGAATTTTTCTATGAACTTTTTTGAAGCCTCCTTGTCCTATTTTTTTCT
TTCTCCCCACCTATCGTATATTATATTTCCCTTATCTATTATATTTAGTCACAGTGAATC
TCTTCCCTTTGTTGAGTGTTGGAGTGTTCTTTCTGTTTTGTTTTGTTTTTAACTGTGTTG
TTGGCATATAATTCACATATTCAATAGTTTAATCACATCGAGAAGAATTGTACAATCATC
ACCCCAATCAGCTTTGGGACATTTTCTTCATTCTTGCGCTCATCATTGTTAGCTCCTATT
TCTTCTCTTATTAGAATAGAAATTCCTCAAAATTAGGGATTCCTGTCTGTTTTGTTCCCT
GATGTTTCCCCACCACCTAGAACCATGGCAGGTCTATAAATACAGGTAGAGTGAATGAAT
CATCTCAATTTATTTCTCTTTCAGTCACCACACTTTGAAGTCTCTGCTGGTACGTGTGAA
GGGCTGCATATGCCCATGCGACATCATTGCTCCAACATCTTATACAGGTAGGAGAGTGAG
CGGCTTCCTTTCTCTCTCAAGTGTCTGGACGAAGTACTGTTGCTTCATTTGGCTGCCGAA
TGTTAATCAGTACAGCACACAGGGTGGTCAGAGGACATGTTTCTAGGGTTATTTCGTTCT
TTCCCAGGAGCATCTGGTAAGGAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved