Echinops_telfairi Locus Mono:105:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:105:SNORA61
Echinops_telfairi
Mono:105:SNORA61
scaffold_295886
SNORA61
1001..1136
2136
ACCGAAGGCCTAATGAATGGAAGCAGAACATTGTCAGAGAGAGTGCCAGAGGATGGCAG
AGGATGGGTTCTAAGGCACTCAAAATAAGACTGAGAAGGAGCTGCTTTCTGAAAGCAGAG
TCAACCATGGGGACCTGAATGGAGTAAAGCCTGTGGGTATAAGCTGTCAGGACCTTCATT
TGTTGATGGGGCACAACACAAAATGAGAGGAAAAAGCTATCAAATCTAATCAAAATTTAA
ATGTAAGAAGTATTAACCTAGGACAATTGGAAGTGGTTAAAAATCAAATGGAGTGCATCA
GTGAGCTGAAATGACCTGGTATTGGCCATTTTGAATCAGAAAACCATATGGATTACTACA
CTGGGAATGACAGTCTGAAGGTGAATGACTTTATTTTCATTGCCAAAAAGAGCATTTCAA
GGTAAATCTTGTATTATGATACTGTCTGTGAAACAATGATATCTATCCATTACAAGAAAA
TCAATAAAACTATTATTCAAGGTTGTATGCACCAGCTGCCAAAACTAGTGATGAAGAAAC
TGAAGAATTTTACCAAGGACTTCATTGTGAAATCGATCAAACATGCAATCAAGATGCATT
GATAATTATTGCTGACTAGAATGAAAAAATTTGAAAACAAAGACAAAGAAACAGTAATTG
GAAAATATGTCCATACTGATATATATGAAACTGGAAATCACATGATAGAATTTTGCAAGA
CCAATGATATATTAATAGCCAATACCTAGTTGCTATCACACAAAAAGGTGACTATACATG
GACTTCCCCAGTTGAAATAAGATCACAAGTGCTCTAATACAACCTTGAGTATCCCACCTG
AAGTTTGAGCACATCTCATGAACCTATTTACTGCATTCAACACTAATAGCAGAAGGTCTA
AAGAGCTATAGGAGTCTATCAAGATCATTCATGAATAAAGCAAAAATAATTAAAAAGACA
AGAAAGAAAATATCCAGGTGAATGTCAAGAATCTGAACCCCACCCTCCAGTTCCCTTTCC
CATCTTATCAAAACACTGGTCTGGATGGTCGTCAAAGGAGGAAAGGAAACATTGAAGCTG
CCCCTCGGTGCGCTTGGAGCTCGGACTAGTGTCAAACAGGGTCAAAAAAAAAAAAAAAAG
AGTCTGAACCTTACTCGGAATCATAGAGTAGGTAAAGCATGTAAAAAGAAGAAATAATGA
AGCAGAAGCACCGAGCAGAAAATATCAAAGGGCAGCTCCAGAAGACAAGGTCAAATATTA
TAATGAAATGAACAAGACCTACCTACAGGTAGAAAACCCAAATAGAAGAATGTGTTCAGC
ATATCTTAAACTGAAAGAACTGAAGAACAATTCAAGTCTCTAGTTGCAATATTGAAAGAA
TCTATGGATAAGTTATTGAATGATGCAAGAAGGATCAAAAGAAGATGGAGAGAGTACACA
CAGTCACTGTACCACACTGAACTAGTCGATAGGCCACCATTACAGGAGGTAGCATATGAG
CAAGAAAGAACAGTACTGAAGGAAGAAATTAAAATGCACTGAAAGCATTAGTCAAAACCA
AGGCTCTAGGAATTGGTAGAACACCAATTGAAATGTTTTGAGAAGCCAATAAAGAATTGG
AAGTACTTTCTCATCTATGCCAGGAAATAAGGAAGACAGCTATTTGTTCAACTGACTGGA
AGAGATCTACATTTGTATCCATTCCAAAGAAAACTGACTCACTCAAATTCTAGAACAATA
TCATTAATATCACATGCAAGTAAAATTTTGCGGAAAAATATCCAACAATAGTCACAGGTG
TATCCTACAGGGAACTACCAGAAATTCAGACAGGATTCAGGAGAGGGCATGGAACAAGGG
ATATTATTGCTAGTATGAGATGGATCTTGACCGAGTGCATAGAATACCAGAATGATACAA
GTATGTTATTGACTATTCCAAGGCATTTGTGTAGATATTAACAAACTATAGAAAACCTTG
AGAAAATGTCCAGAATACTTCATGGGGTTCATGCAGAACTTGTCTGTGAGTCAAGAGGCA
GTTGTGCAAACGGAATAAGAGAGTACTGCGTATTTTAAGATCAGGAAAGGTTTGAGTCAG
GGTTATGTCCTCTCATCCCACTTACTCATCTGTATGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved