Echinops_telfairi Locus Mono:583:SNORA79
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:583:SNORA79
Echinops_telfairi
Mono:583:SNORA79
GeneScaffold_3793
SNORA79
1001..1145
2145
ATTTTTTTTTAATGAAGAATTCTCCTTGTGCAGTTTAATGGTAATATATAAACTAACAT
ATATATGAAGTGAGGTTAAAAATAGCAAGCCTTAACTGTAGGATGGTAGGTTGGATTCAA
TCCTAGAAAAAAGGACTTTAGCGGGAAACAGGTGAAATTCCAGTCGCCTGGAGTTGGTTA
GTAGTATTGGACCAATGTTAATGTCTTACTTTGACTAATGTACTATCGCTATATAAGAGG
AAGCTGGGTGAAGGGGACATGAGAGCTCTGTACTATCGTTGCGACATTTCTTTAAGATTA
TGCCAAAACAAAGAATGATTATTTTTCAATTACAAATGAAAGTCTAAAGGCGGATGACTG
AGAGAAAGGAGGTGAATACAAGATTTTGTTTTTGCTTGTGTTCCTTTGATATCATCTTCA
GTTTTGGAATGGTGTGAATTACATATTAAAATGTATATCTGAACATTTTAAAACCTAGCT
TTACATCTATCTAAGAAGTCGGTGGCATAGTGGTTACGTGTTGGGCTGCTAACTACAAGG
TTAGCAGTTCAAAGCTACCAGGTGGGCCGAGGGAGGAAAATGAGGCCTTCATCTCACCTA
AAGAGTTCCAGTCTCAGAAGTCCACAGGGGCAGTTCTACCCTGTCCTATGGGGTTCTTAT
GAGTAGGCATAAATTGAGTGGCAGTGAATATACATCTGTATATGAAACTATATTGCACGT
TAATATTGTACATTGAATTACATATGACATGACATATAGAATTCCATGACATAGGAAATT
GCGTATTATATCTTCAAACCATCAAAAGGTATCCAAAATCCATGATAAAAGCGAATGCAT
AGAGATATTGGTTAATATGCTGAGCTACCTCCAACACAATAGGGACACATTCTTGCATTC
ATTCCAGGGCTCCTTTCGAGGTCTCTGCTCCCTGTTCAAGGTGCTGGGGAATGAGTCACG
AACAAAAATCGATAACATGGTCTTAATAACAAAGATCTTATTGATGACTGTGCCTCCTCT
TGCCTTCAGACCTGACACTAGGGTTTTAGGTCATCATAAATAAAAAATTGATTTTCTTCA
CTCAGAGAATAATAGAATAATGGGTTTTATCTGACTATTCTCTGAAATTTGCGGAATCAA
ACAGCTCCTAACAAAATTTTTTTAAATTAAAAAAAAAATAACAAAGATCTTAAAGGTTCC
CTGAGGAATGAGACTGGTGTCAGCAGCTGCTAGAAGAGCGCCCGTGGTCCCTGATGCCTG
GTATTAGCTCCCTTGTGGAGTCTCCTCCCCTGGAGTACAGATAGGCTGGTCGATTTTGAC
TCCCTTATAACCTATATAATTTGGCAGCGGTGATGGAATTTTATTGCGGTCATAAGGTTC
TAAGAAGGACTGTGGCTTCCTTCTTAGGCTCACACTCTGGCTGGACGAAGTCAGCTGACA
TCTCATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTCCACGACTATGGGTCTAGCAGCCACTGCAAGAAGTAATTTGTAGGTACAT
ACTTCCCCCAATTGAGCCACCAGATGACTTTAGCCCTGGTCAATGCTTTGATGGCAACCT
GAGAGAGACCCCCAAAGCCACCCAGCTAAGCAGTTCCCTGCCCCCACTGCCCCATATAAC
CCATCAGCTATTGAGTATCTGTTGTCCCCAGCCATTATCTTGAAGTAATTTGTTATGGCT
GATGTCGCTCAGAGTTATTGTCACTAATGGACAGACACTGGGCAGGTAAAAGGTGACTTA
GTGCAAGGGTGATTTGAGGGTCTTTCCCATCATCCTTTTCAGTGAAGCTTCCTAAGAAGC
AGTCCTGGGAGAAGAGCAAGGGAACTGGGCAGAAAAGAAGCTGGCTCCTCAGGAAGGGGG
AGTCAGAAGAAGGAAATGGTGAGGGACTAGTTCAAGGATGCAGACCTTTAGATGGCCGCT
CGTGCTGTTGTGGCGCTACAGCCAAAGCTACTGCAGGATGGAGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved