Echinops_telfairi Locus Mono:176:SNORA38
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:176:SNORA38
Echinops_telfairi
Mono:176:SNORA38
scaffold_312540
SNORA38
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTCCTACAAAGGCATGT
CTGTGGTTGCCTGTTCTTGGCACAAGTAAGAATTGGAGGCAAAGAAATGTGGATTTGGAG
AAGTTTGGGGCCAGCTTGCTCCTTGCAGGCTCCAGCGCCCCCATCCCACACTGAAAAAAA
AATGGCATTCATTTCTGTCCTTTTGTATGATCTCTCCACTGTGAATTGACTTTTTTTAAT
CACACCACTAAAACTAATTAAATCTGCCAAGTGTAATGAACAAATGACCATATTTGACCA
TCACATCTCAATCTTCCTGGTAATATTCATATTAATGATAACTAATATTTGCTGCCATTT
TTTGATATGCCAAGATTATATGATCTCTTTGGCATATATTCAATCCCCACAGTGACTCTA
CGAAGGAGTTTCATTTAGTTTCCCCATTTTACTCTAAAGGAAATATAAGAATCAGAAAGA
TTATGTAAATCTCCTTATCACATTGGTATTAAATGGCAAAGTTTGAGTAAAATCTAGGTC
ATCTTAAAACTCTCTAGTCTCCCTTCCCTTGGAAATTCTTCTTTTCCCATGCAACTTTCT
GTCTCTTCCAAATCTATTCTTGGCTGATCCCGCTTTCCATTCACACCTCAGTCACTGGTT
AACAATCTCTAAATTTCAATCTTGCTTGCAACATAAGTAACAAATATTTTTTTTAAGACT
AGAAATATCATAATACCATTTTCCATTTAGTATGCACACACAAAGTCTGAGAGACACTGC
TGTATAGTTCCTTAATGATTGGCATTTAGTTTCACAAAGATGCCTGCTTTATATTAAACT
GATATTTTGAAATGTATATTTCCTGATAAAATATTGCTTCTTTATTCCTATCTCTCTCCT
TTTCTTCTCTGATCTTTTTGCTTTCTGGACAACTCAAATTGCAAGTAATTCATCACATTT
CTTCCTCAATCACTTTGAGAAACCAGAACATATGATCACACTGTATTCAATTCCCTAAAT
TATTACATTTTCCTAAAAAATAATGTTAATATCTCATAACATGTCATGCATGGGCCATGA
TCTTCTTCCTTCTTTATGCGCCAGATTCGTTTCTTGGTAAACCATAACTGAAACAATGTA
TCCTCATATTCCTGAAATCTTCTATTCACATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved