Echinops_telfairi Locus Mono:83:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:83:SNORA44
Echinops_telfairi
Mono:83:SNORA44
scaffold_314581
SNORA44
1001..1130
2130
TCTCCTCTTCAGAACATGAATGACGGTGAATTCTAAAGCCAGAGATTCACATAGAGCTA
CCCATTTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAAAGCCA
GAGATTCACATAGAGCTACCCATTTTACTGGGTGTCTTAGGATAGAACCAAACCCAAAAC
CAATGCCATCAGGTTGATTCCAACTCATAGCGACCTGATAGGGTAGAACTGCTCCTGTGG
GTTTCCAAGATTATAACTCTTTACAGGAGTAGAAAGCCTCGTCTTTCTCCCAGAGCAGTT
AGTAGCTTTGAATGTGTAACCACTACACAACCAAGGCTCTCCGATAACAGAACAGATATG
AAATACAACTTTCCTCTAGTTCCTAAATGTTTCCTCCCCGCTCCCACTACCATGACTCGA
ATTCGACCTTGCAAGTCTGGCTAGACCAGAGGAGGTAAACTGGTACAGATGGGAACTGAA
AATACAGGGAATCCAGGGCAGATGAGCCCTACAGGACCAGTGGTGTGAGTGGCGAAACAG
GGAGGGTAGAGGGAGAGTGGGTAGGAAAGAGGGAACCGATTACAAGGATCTATATGTGAC
CTCCTCCCTGGGGGACAGACAACCGAAAAGTGGGTGAAGGGAGACGTCGGACAGGGCAAG
ATATGACAAAATACCAATTTATAAACTATCAAGGGCTCATGAGGGAGGGGGGAGCGGGGA
GGGAGGGGAAAAATGAGGACCTAATGTCGGGGGGTTAAGTGGAGAGAAAATGTTTTGAGA
TTGATGTACAAATGCGCTTTACACAATTGATGTGTGTATGGATTGGGATAACAGTTGTAT
GAGCCCCTAATAAAATGTTTTTTTTAAAAAAAGACCATTGAGACCAAAAAAAAAAAAAAA
AGAAAGAACCATGAGAACATCAGTCTCTATGACCCGGGATGAAAAGAGGTAGGTGGGTCT
GTGGCTCGTGTGGCCATGTGATCTCCAACTGCATGCGAGAGCAACGTGGAGAGACTTTGA
CAGCTCAGGCCAGCAAAGTATCTGCAGCTGCCACTCGCCTTTCCTATACAATTCTCCGGG
ATCTGGACAAGAAATCCAGTTTTCCCTCGCTTCCATGTAGATCTGAGTAGCAAAACAGCC
CTGATGAAGTACAAAAGAATGGATTAAAGCTTCAGCATTGAAGCACTATGGGAAGAACTT
GAAGCAAGACGTTTTATATGCAGAAAAAATTTAAATGTACCCGGCTTAATAAATAAAAAG
ACTTGTGGAAGTGAAAAAAAAAAAAAGAAAAGAGGTAGGTGGTACCCAGTTACCACTACA
CTCTGCTCTCTAAAATGGAGAGTGGGAGAAAAATGTGGACCCAAACTCAAAATGTTTTGA
GAATGAAGTACAAATGCGCTTTACACAATTGATGTGTGTATGGATTGTGATAAGAGTTGT
ATGAGCCCCTAATAAAATGTTTAAAGAAAATAGAACAGATATGGCTGCCTTCCCGCATCT
TGAAGGCTTATGAGCTGCCACATATAACCCCCCCCCCCACTCCCATCCCCATCCCAAGAA
CCAAAGCATGTGTCTTTTGGCTAGAGAAGAGGTTGAGACTGTTTATTTGAGGAAAGGGAG
AGAGGATAGGGTGTTGCTCTTTCAGAATTCACCCCCAACCCATGTGTTTGGTGCCCGTCT
GTGGCCATAATCTCTTCTTCCCCCAGTCTTTAGATAATGTTCCATGCAATGTATTCCTGG
GATATGCTGGATCTTGGCCTAAACCCTTGACTTTGGTGTCACTCGGTGATCCTTAAGTGT
AATCCCCAGACCAGCAGTATCAGCATCACCTGGGAATGTGTTAGAAATGTAGATTCATGG
GGCATCTCCAGACTTGATTAATCAAATACACTGGGAATGAGACCCAGAAATCTGTATTTT
TAACATGCCCTGGAGGTGGTCCTGATGCAAACTCCAGTTCGAGACTCATTGGACCAACCT
TGGCCTTCATTGCCTAACAGATGACTGATTACTCATGTAGTCTCATAGCAGACTCACATC
CTCCCAACTTGCAATCCAAAATGCCTAAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved