Echinops_telfairi Locus Mono:236:SNORA26
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:236:SNORA26
Echinops_telfairi
Mono:236:SNORA26
scaffold_282525
SNORA26
1001..1127
2127
CAGGGTCGTGGCCCAGTCCTGGTGTAGCTACAAAGATGCTCTTCCCTGTCCCCCGCCTC
CCTAAGAGAGTCCCGGAAGTCAGCCGGCAAGAACTAAGGCCAAGAAGGCCACGCCTGATA
AGGCGCGTGCAGAATCCAGCTGCGAGTCCACTAGGTCCCAGAAGGAAGCTTAGCACAGGA
TCTCTCAGTCTTCCCGCCACAGCCAGAGCCAGACCCACAAGGCCCAGGCCAGGGCGGGCC
GGACCGCGGGCAGCCAATGGCCGGTCCTATAGCCCGCAGGGCCTCACTGCGATTGGCTGG
ACGTCCCAGCCTGCCTGGGGATTGGCTGCTGATGCACAGCTGCTCCGCCCCGCGAGCTAG
ACCTTCGCGGGCCGCGCAGCGCGTCGCTCTCTCTGCTCGGCCCCGGCTCGGACGGTGAGT
GTCGCTCGCCTGCGGCCCTGCGCGCGGGAGGGCGCACGGTGGGCCCGCGGGGGGCGGCCG
GGGTGGGCTCGTCCCCTCGAGCTTTGCCCGCCCGGAGCCCTCTGCTCCCGGCGGCCAGAA
CGCAGGGGTAGAGCAGGCTCGGCGGCCCGAGGGGCGGGCGGTAGTGCCCGCGCCGGGGCC
GCCGAGGTACAGGCGCGCGCCCGCGCCCGGAGGCCCCGCAGGCGGCCGGGCGCCGCGACG
AGCTGGCACTTTGCTTCCGCAGGGCGCGGCGCCGCTCCTTTGTGCGCCGGGGCCGGACCT
GGCCTGTCCACGGCGGCCGCAGGCGGCCTCGACATCCCCGCGGAGGCGCAGCGGCCTTCC
AGCTCCGTGCAGGTACGTCCCTGACTTGGGAGAGGCGGCGATCACGTGACCCATGGCGGC
CTGAGGTCCGCGAGCACGTGTGGGTGCAAACGCTTAGTCCAGGTTGATCCTTACAGGAAG
TTCACCTGCGCGGCTGCTTCTGCTGTGGCTTAAGAGGCCGAGGGCGGCGCTGTGCGGCAC
GAGGGAACTGCACACAGACCGATGCAGGGTCGCCCTTTCTTGTGCCCTTTTAAGGTTGCT
GCGGTACTTTAAGAGGCTAACACAGAAGGGTAAATAAAGCAAGTCTCCATAAAACCCAGA
GACGAGGTCGGCAGAACTCCTCTTTGGATCCTGTCTGGAGTCACAACTGAACTGGAAGCA
CAAGCACGTGCTTTGTATAAGGTTCTCAGCCAGCACTTGGCACCTTTGCTTTGAAGATAC
GTACCTATAGGCAAAGTTGATATCTGATGCTTTACACAGTCTGGGGGGGTGCTGTGAATG
CTTCAAATAGAAACGGTATCTAGATACTTTGCTTTTTGTTTAAGGTAGGAAAGTGCAGAT
TACTGAACACGTGTACTCGGGGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved