Echinops_telfairi Locus Mono:325:SNORA7
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:325:SNORA7
Echinops_telfairi
Mono:325:SNORA7
scaffold_296348
SNORA7
1001..1137
2137
CTAATTTGATAGGAGTATCAAGTATGAATTATAACATTTAGTACATATACACCCCCCAG
TCATGCCCCGAAACCCAAATATAGGTGTAGAGAACAGTGTTGGGAAAAGACAAAAATTAG
TTTTCCAGTTGACAAAATCTGAAATGGTAAAATTCTAATATTTTGCCTCAATTGATGAAA
GCCTGTTTCTGAGAGGGTAGCACAAGAAGTTAAAGGAGTTCTGTTTCTCCCCGCTCTTCA
CTTCCCCCACAGACCAATGCAGACTATGGAATGTGAGTCCACAAACCGCCACATCTCCAC
TCTTTACCTTGTGAGAAGGCCAAAAATGTTTAGCTATGTCAGTGGGTCCCATGGCCAAAC
CTCATATTTTTATGCATAAATAATTGGGAGTATGTGTAACACTCTGTCCTCAGGGTTTTC
AGGGACTGGGAGGGCGTAAATCATCTTAGAGTGCTGAATAAATGCAGATTGATAAAGAAA
TGTACACAGGTTTATACGTATAAATTTACAGATATTAATATGCTGGAACATTTTCTCCAG
CAACCTACAAATAACATCTGGACCTCAAATATTTGAGAAAGATTTAGAAGTGCAGCAACA
GTTCCATTGCTGTTTCTCCTTTAGGGACCGCAACTGGCGATTTGTATGTGACTTGGAATA
GCTCTGCTAGTAGTCTTTGCATCCCAGAAACTTGAATATGGAGACAAATCGCAGAGTACG
AAGGCTCCATCCACAAACCAGTTTTCACAGTCTATAAAGTTCTACTCTTATTTCATGAGA
ACTTTCTAAAGAAAGATAAGGCTCCATTTGAAATGACACTTCCTCTTGATTCAAAGACCC
TCATTTTGTTCTTTATAATATTGGGACATATGTATTGTTTTTTTCCTATATAATGATGTT
TCTGAACTTTACTTTTGGCTCATGGATCATTTTAAGAATCTGGTGAAATATACGAACCTC
TTTCCCCAGGAAACAAAATTCAAGCATAAAAAAATGCACATGGCCTCGCAGGATCGTATC
TGGAGAATAACCAGTATTCTGCCAGCTTCCGAGACCGGAGGCAAAACAAGCCTGTCAGAG
ACCCATTCCATTCCCCCTTGCTCAGTAACTAGTGAGTGGAAGCTACTCTGCGACAGTGTT
CAGGTCCTGGGCAGGGAGGCCTCCTTCCAGGACTCACTTGACCGAGATCAACCTCTTTCT
TGAAGGCACCATGGCTGCCCTCAGACCCCTGGTGAAGCCTAAACTTGTCAAAAAGAGGAC
CAAGAAGTCCATTTGGCATCAATCAGACCGCTATGTCAAGTTGAAGCACAACTGGTGCAA
ACCCAGAGGCATTGACGACAGGGTGCGGAGAAGATTCAAGGGTCAGATATTGTTGCCCAA
CATTGGTGATGGGAGCAACAAGAAAACCCAGCACCTGCTGCCCAGTGGCTTCCGAAAGTT
CCTGGTCCACAACCTCAAGGAGCTGGCAGCACTGCTGATGGGCAACAAGCCTTATTGTGT
AGAGATCGCTCATCTTGTTTCCTCCGGGAATCGCCAAGCCATCACAGGCAGAGTAGCCCA
GCTGGCCTTCCGAGTCCCTGACCGCAACGCCAGGCTGTGCAGCAAAGAAAAGGAATAGAT
GGCCCATTTGTGAGTTGATTTGTGCTAAAACCATAAATGAAGGGGGGGAAAGCACATGGA
TTTTCTTCTAATTTGAGGTTTATATATCTCCAAATGTCAATTTATAGATATCACTGAGGA
TCAGTGTTCCTAAAATTAAGAGTGCCTCTCTTAGAAGTTGAAAACAAAGCATGTTCTCAC
CTAGGAAAAGGGGAGGTGGGGGATACATTTAAGACTTTCAAATGACCACAAATGTAAAGA
AAGTATGCAATCTAGAATTATAGCTGTGATCGCTTCATTTCAGGAGCAAAACCAAGAAAG
GTAATATGAGGAATTGTCGCAAAACTGTGAGCTCTTTTACGCTGCAAAAATAACAGCAAA
ATATGTTTAAAGATATTCTTGCTGAATGTAGAAACTGTGACCCTTGGCTGCTATCAATTT
TTTTCTATTTTTCTTGCCAAACAAGTGTTATGAAAGAATATCTCCAGGCATTAACTCTAC
CCTGAGGGTTAAAACATGTACAGGATGGAATTGGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved