Echinops_telfairi Locus Mono:561:SNORA7
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:561:SNORA7
Echinops_telfairi
Mono:561:SNORA7
GeneScaffold_6218
SNORA7
1001..1134
2134
TATGATCGTTAAATTATGACATTCAAAGGGATGAAGTCAATTCTACTAAGAGTCATCAT
TTGAAAATGTGAACTTCCACTATCAGTTTGGATTTCATGTATGTTTTGGCCCATTTTCGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAACTGAAGGTTAAAAAAAAAAGTATGCCCCCCAAA
ATGAATATTCATATTGGACATAAGCCCCAGATTCTGCATTGCAAATTGAGAAACTGTCTG
TAAGTTTTGGAAACTGTTGTAAAAGAATCTGATTTACAGGCACAGGGAGTGGGTTGTTTT
TATGCGATCATGACGTGATGGGCATCGGAGGGGAGGGTTCTAGGCTGGCTGGCTAGTCAC
TCTCAACCTGAGATGATTATTCCTGAAAGACACAGTGGGATTTATAGGAACATGTCAAAG
GGTGTGAACTTTTTATATGTGTAACATTGCTGTATACAATGACTCTTGATTCTCATCTAG
TATTTCTTTAAATGCATTTTTAGGGAAGTGAGTTGTAGTTTATGAAAAGAAATTTATTTT
TTGCTACAAAAAGTCCTCATAACAGATTTTGCTCATAAATGTGATCTGCTTTTGCCTGAG
AAAGGCAAGAAATTTTAAAATTTAAAAGAAAACAGCCAACTGCCCTTCCAGGATCGCCTC
TGGAGAACAGCTCGTATTCTGCCGGCTTCGGAGACGGAGGGAAAACAGCCTGTCAGAGAC
CCATCCTGTTCTCTGTTTGCTCAGGAGGTGGTGACTGGATGATACTGCAACAGGACTCAC
TTGACCCAAGTCAAAAAGAAATTAAAAAAAAAAAGAAAGAAAACAGTAAATTGCACCCTT
CCAAAGGAAGTCTTCACTGGGTAGATTTAGCAAGAATTACTAAGTGCTATGCCCAGACAT
GGCCGACTAGGCAGGCCAGAAAAATACATTAGATCGGAAAACAGACGTGCTCTTGTTGGT
CCAACTGGTACGGCTATTTCCATCAAGCAGCTCAAAGCAGGGAAGACCTGGAGCTGAGGA
TCCTGGGTGGCCCATGATGGGTAGAGGCTCCATGGTGCATGTGCTACATCAAGGCTCATA
CTGTAAGGTGGGTGGCTCTTAGAGAGAAAAACATACTGGGCTATGAATTTTTTCCCCAAC
AGCCTAAGAAATCTGTATTACAGCATACATTTAACGCTGACTGGGGGTGAGGCATGACAT
CATAAAAGATAAATGTCCTTTATAGTTTTTTGATTGACAAAATTTTGGTAGAACTGAGAA
TTTAATTTTAGAAATGACAATACAATTTTGTCTGTTGAAAATGTCTTCATGTACTTGCAT
AATAAGGTATTACAAGTCTTTTAGCAATGTTTTTAGCTTTTCCTTTCTCGGGTAATAAAT
TAATGACCCTGAGATGAGAGTTTGATTTATGCTAAAGATATCTGAGCCAGAATGTTTAAT
ACATAAAATCCTAACCACTATACTCTAGCTTTTTCCAGTCTAACTGCTGAAATGCTTCTC
TAAGAGATGTCCACCTCTGAGCAGCTGCCCTTGACCCTCCGAGCAGAGAACTCCACCTCT
TCCCTGACCCTGTGTTACATTCTGACTGCCTGTATTAGAGCTTAATCTTATTACATGGTA
ATTATTATTTATGTGTTTTCCTTCCTTATGCTCCTTGAAGGGCAAGGACTACTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved