Echinops_telfairi Locus Mono:151:SNORA5
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:151:SNORA5
Echinops_telfairi
Mono:151:SNORA5
scaffold_24466
SNORA5
1001..1136
2136
AAACAATATCCTATGCCTAACCATTGCAGTTAAGTGAACACCTATACCATAATTCTATG
CATATCTTCCCTCACCTATGAAAGTTTGTAAGCCAGCCACTTCATGCCTTTGTCCCCCCA
TTTTGGGTACCCAATTTCTATACTGCCCACTTATATCAAGCCAGTGCTTTGAAGAGACAA
TCATATTCTTTGATGTGAAGAATCTTCTTTCCAGTTGGAACCTTGTGAAGTCTGCATCCA
TAATCAAATCAAATCAGGACAGGCCATCCGTAAAATCAGCAGCAATCTGTACTAGTTCAC
AGGCTCAGAAATCTTCTCTTCATCTGCTCAGGTTCTGGTCATCTAAATGTGGGCTCCCTC
AATTAGCCCCATGAGGGTGCCCATTGGTCGCCTTGCCTTTAGACCATGGCCCCATCACAA
ATTCTCAACAACTCTAGCCCCCTTGGGCTAGGACATGAACTTCAGATCAGTCAATCTGCT
CTTGTCTTCTCCACTGTTCCTTGTGAACCAGGTCCACGGGTGTCAGTGGCCAGACTCAAC
CCACCTCTTTAGTGCTGCATTTCTCACTTCCACTCAACAAGTGAACTCAGGTGGTCACCT
AGCAAGCATTTCAGCCTGCCCACAGGCTCTCTTTAACATTCAGTCCTAGAGTAGAGGCTT
TCTTTATGGCTCCAAATTTTTTCCAGTTTTTGACACAAACCACTAGTTCAGAATTCAAAA
AGCCACGGAGTTCCTTATTTTTCCCCCTTCAGTCTGTCAATAGTGTCCTAAGCAAGTCGC
TTCACCTTCGCATGTCCTCAGCACTTAGACACGGGGTGGAGTTTAGCTTTTACGAGCCTC
CTTTGCAGGCATGTCCTAACCCATTTAAATTCCAATTTGGTGGCTGAAACAGTGAGCTTA
CAAACTCCCTATACTTACCAATAATAATTTCCATCAACCATTATATCAATAACAATAGTC
AAAAGAAAACAATATAAATCTAATGCAGTTAGATCCTAAACTCAATTCTTAAAACAATCA
CGTTCCTGCCCCACCCATGGCTGGCACTGGCCCAAAAGGCTGCCACAGAGACACTGTAAC
ACATGGGCCCTGTTCCTCTCTGCTGAGCCTCAGGGATAAATTGTGTTACAGACATTAAAA
AAAACCCAAAAATAATAAAACAATCAAGTTCAATCCTTATCTAAACTTATCTTAATCCTT
ATCTAAATTATTCATACATCTAAATTATTTGATACAAAATATGGCCTTGTGACTCTGACT
CAATCAAGCCAGGGCCAAGCTTTCTGTTGGCCATTTTGACCTCAGCCAGTCATTTTCTGT
AAGTAGCAGGGTTTCTGAGAAATTCAAGGAGAAATGTCATCCCCTGAGTTCAAAATATAC
ATTACTCACATTCATTTTCAGCATTTCAAACAAAAATAGCCAAAGACAGCAACCAAACTA
AAGAATCAAAATGTTAACTTCCCATATTCTTTCCAGAAAACAACGCAGTAAACTGCTTGG
CCACGTCTGACCTTGGTTAGCCAAAGCAGCACAGCCACCATGAGGCAGAGGTCAAACAAG
CATCTACTCTGCTCTGCCTTTATGGTTTGTTTCTCTAGGACCCCAATCCCAAGGTACTAT
AATATGTTAGTCAGGGTTGACTAGAGAAACAAATCCATAGACCCTCATGTGTGTAAGAGA
GAACTTTATATCAAAGAGAAAACATCCCAGTCCAGTCCTGTTCAATTCCACTAGTCCAAT
ATTAGCCTGTGTGTCTGATACCAGTCTATGAATTCCTCTTCAGACTCATGCAACACTTGC
AATGATGTCAAATGCAGGAAGATCATAGGCCGGTGGGTGGAGAGTCTTGCGGATCCGCTG
GTGGTGGAAGCATCTCTGCACTGGTATGGGTCTCCACGTGGCTCCTCCCATTCTAGGGCT
CTGACTCCATCAATGTGGCTCCAGCTGACTTGTCAGCAGGAATGTCCCTCAGGAAAAGTG
TGTGTCTCACCTCCAGGGAAGAAGACAGGAGTTCCCAGAATCCTCAAGAGAAGGTCATGC
CCACACAGAGACCTCATTTAGCTGTGACCTGATTGACAGGCTCGACTCCACCCTTTGCAA
GTTGACAGATGATGTAACTGCCACAGAACACAAATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved