Echinops_telfairi Locus Mono:553:SNORA1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:553:SNORA1
Echinops_telfairi
Mono:553:SNORA1
GeneScaffold_474
SNORA1
1001..1131
2131
TCTTACTATCTTTCAATCTCATTTTCTCCATGAACTTTTTGAAGTGTATGCCTTTCACT
TATGTCTACCACCAGTCAGCTGGTGGGCTGTATGCCCCTACAGCAGTATTACCAACAGGT
CTCGGAAGTTGTTACCTTCTGTTATGTTGTACAAAATGGCACTGGTCCCAGGCTGTAATA
TGCAGCTCTCTAGTGTAGGGCAGTGAATATGAAGGCAGTTGACATTGTCATGAATGGGAT
CGTGGTAGAAGACAGCCAGGTTACAGGAAACTGCAAGGGAAACAGATAAAGTATGTCTTT
GTCAAGAGGGCTGGGCTTCCATGGGAGTTCTGAGTAATTATATTGCTTTCAAGGACGCTG
GCTCCCCTGAGTATCTTACAGGATTATGTTCAGAGAGTTTACAGAACATTAACAACGCTT
ATTGCAACTGTGCTTTGGTAAATCTGTGAAATACCTACAGATTTTTCTCTGGTAATCTTT
TATGTGGTTCATTCTTCCTAGGATTAGCTGGAAGCATTCTTTTCCAATCCCAGTCGTTTG
TTAGTGAAAATTAATTTGCTACAAGAATCTCTGGTGAGTTTTAAAGCCGGTTTCTTAGCA
CAGGACCTTCTCAGAATGCCAAGGTGCTATCGTCATCAGGGAAATAAACGGGCAAATGCT
GTAACAGAACATGGGCATCACAGGAAAGGCAAACAGCAATAGCTGCATACCTGGGTAAGA
CGCATGTGGTGGAAAGGTAGTAGGCCATGGGAACGTTACCCTTGACCCTGAATGCTGCGT
GCACTAGCCTCGGGTAGCAAAACAGATCTGACGGAATGCCTAATCTGGCTCGTGGGAAGC
GGAAGGGAGGGGAGAAACCAGGATGTTCGTATCGGGACTTATGGAGGAGGACAACACCAT
TTGCTTAGCCCTTCCCTTTCTATGCAGACTTGTTCCGAAAAACATAGTGTGTTATTTCAG
AAAAAGCCTGTTGATTTTGTTGCATGAAAAGCCTCCGTTGCAGCCTCAGTCTGTGAAAGT
GGGCACAGCTGATCACGGTGTCCAGACAAGCAGTTGTGGCTGAAAGGATGACAGGTTTTG
CTTCCACCACTGTGGGTTAATTTCAGTGGTGACAATGAGACCTGTAACACTTTGCTCAAG
CAATACTAAAAGTTAGCAATGTAGAAATATTTAGCACTAATACTATTTACTCCCAAAACA
TAAATGTACTTTCTACTTCTAGGGCCCTAAAGGGAATAACAGACTTTTCAGGCATGAAAT
GTTTGACATTTGTCCATAATGGAGGTTAAAGTGGTGTAACCAGAAGAATTGACAGGTCTG
AGATTAATGCTTACTAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGTAGGGACCATGTGATGTGAAATATCTA
TTGGCCACAAGGTATCCATTTCTCCAATAACGTAAGATTAGAGAGACACAGCCTGGTTAG
CAAACCTCAGCGCATTGTTCAACCTGCTGTGGAACTGCTGTTGGCAGGGCCTGTGCGGCT
TCTGTGTCAAGTTACCTGTGGGCAGCTTCATCTCTACTGGTACGTTGGGGACACCCAATG
TGACTACACTTTTTGTTTTTCTCAAAGTACAAAAAATTGAACAAGCATCTTACACTGTGT
TGTCATGTGCCATGAAGACCATTCCAGCTCCCAACAACCCTATCGGACAGGATTTCCTAG
GCTGGAGCACTGTTGTTGTTGTTTAATGTCTATTTTTGGCAAAAATATGCAGTGCAAAAG
ATACACCCATTCAATAATCTCTACACATACGGTTCAGTGACATCAGTTTCATTCTTTACT
TTGGGTCAACAGCTCACGCTTTCTACTCAGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved