Echinops_telfairi Locus Mono:111:SNORA61
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:111:SNORA61
Echinops_telfairi
Mono:111:SNORA61
scaffold_280066
SNORA61
1001..1117
2117
CACAATCCTGTAAGATGGATGAGAACTGTCCCATGGAGTTTCCAAAGCTGCAAATCTTT
ACCAGCCGCATCTTTCTTCTGTGGAGTGACGTGATTCATGGAACTGTCGCCCTTTCTACT
CGCAGTCCAGTGCTTGGCAGATGGTGCCACTGGGCTCCTTTTCCTCTCTACACTCGTGAG
ACAATAGTTGGAGAATTCTGGTTTGAAAGGGGGCCCGATTTCTTTTGCTCCTTGTATTAG
CCACACCTCTGTCTCGCTCTGAAGTGGGGTGACTAATGCTCTGTCTCAAACAACGCTCTT
TACCTTTCCAGCTCTGCCGCCCACAGCATTCCTTGCTTTTTAAGTTCGGTTCCATAATTC
ATTGCAACAGCCCCCCAGAAGTCACAGGCAATGCTCATGATTAAGGGGTAGATGAAGGAA
GCTAACAGGTTACAGTGCAGGTGAGAAATGTTCAGGACATAGCTGTTCGGTCAGGATATG
TTATCCAGTCATTTTAGAACTGCGAATAAAGACCCAAAGGGCATGCTACTCCACCACACA
CCTCAAGCCCCAGCACTCAGATCCAGCTCCCGCCCCACGATCAGCAAACTCCTCGGTGGA
ATTCAATGCCTAGAGGCACCCTATTCCACAAGTGAGCTTCTGGCCCCAACGTCCTCAGCT
CTACTTGCTATGTGAGTTAGGAAGTCCCCCTACTCAGTCTCAGGCCTAGCTCCTATTCCG
ATTCTGTGGCTCCTCTGTCACGCCTCGAGTGCCAAAGCTGTCTCTGGATCAGAAGTCCAC
TGCACAGAGAGCTCAGGGTCCAGAGGAGGCTTCTCAGAGTGAAAGCCAGGCTTCCTGCTT
CTACGACGGTTCCCCCTGCACCCAGCAGGACGGCCATCACAGCAATTCCTGTTACCCAGC
ACTCAAAACCCAACAGCACTCATCCCTTACCCCCACCAGACCCATCAAGACAAGATTGTT
GGATGGGAGGCACAAAGACTATGGGTAGAAGAATTACGTTAACCCTCCAGTTCCCTTTCC
CATCGGATCAGAACACTGGCCTGGGTGGTCGTAAAAGAAGGAAAGAAACTGGGAGCTGTC
CCTCAGTGCTCTTGGAGCTCGGGCTAGTTCAAACAGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved