Echinops_telfairi Locus Mono:578:SNORA44
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:578:SNORA44
Echinops_telfairi
Mono:578:SNORA44
GeneScaffold_5433
SNORA44
1001..1114
2114
CCTACCCCCGGAGCCTCCGGGGCCCAGGGCCACACTGGAAGGGACGGCTCACCTCAGAG
TCTGACAGCTTCTGGAAGTTGGGCGTGATGTAGAAGAGGATGCCCTCTGTGGCCCCGGGC
AGCGTCACCCCCCGGAAGAACAGGATGATCAGCATGATGTAGGGGTACGTGGCAGAGAAG
TAGACCACCTGGGAGGGCAGGGGGAGCCGGGGTCAATCCCCTCCAAAGCATCCAGCTTCC
CCTCTCCCACTCCACCCACATCGCCCTGGCTGCCCGGGCCTTCTTGCCAGGTCTTCCTCC
TTCAGGAAGCCTTCCTGGACTTCCCCAGTCTGCTCCGATTGGTCACCTTGGACTCTGAGG
CAACCAGTCAGCACCTGATTTTCCCCTTTCTCTTCTTTATGCTCTTGGTAATTGATTCAG
TAATTTGGTGAGAGTAGAAAAAAAATTTTAATTAGCTATGAACAGAGAGAGAGGGAGGGA
GAGAGAGAATTGTAGTCACATCTCCTGCCAGGATAATGCAAATTACATGATGGGCAGCAG
TTCTCTTGTTTGGGCACCAGGGTGCGCAGTGGACAATATAAATGGCTCCAGTTGAAGGAA
TGAGGTTCCTGGGTGGTACCTGCTGTTTGCTATTGTTTGTTAACCTACAGGTAAGTGGTT
CAAACCTAGTGGCCCCTCTAGAAAAAGGCCTGCTTGGGAGGCACCTAGTATCTGCACCAT
TCCCAGCCAAGAACACTCCCGGTGTGGAGTGGAACCCGCCCTGCCGCGAAGGCCTAGGAT
TCTTGTTGTTTGTTTAGGGATGGATCCATAAATGTGGGATGGTTAACATTTTAACTTCTT
TTGAGAATTTTTTTCCCATTGACAATCGCCTTTTATTTTTTTCTCCTTTTACTCCAGACC
ATTGTATTGGGAGCTAATACAGATATCTTATCAGCCCCACCATTTGATCCCGTCAAGTGG
TCAAGCAGTGTTGCACCATTGCTACCACAATCAGTGTCACTGAGCGCCTTTGAAGAACAC
AACGTATCTCCAACTGCATGCAAGGGCAAGCTGGAGCGGCGGTGACAGCTCAGGTCAGCA
AAGTCTCTGCGCTGCCACTCGCCTTTCCTAGAAAGTTCTCCAGGACCTGCACAAGGAAGC
CTCCTACCTAAGTCCAGTTTCCATCAGCTGCCATGTAGCTCTGTGGCTAGTAAAGCCGCC
TTGAATGTGGTGATGCACGAACGAGCTAGAGTTTCGAGCACGGAAGCTCTGTGGAAAGAA
AGAACTTCAAGCAGGCCATTTTGTATGCCGCAGAAAAAATTTTAAATGTACCTGGCTTGA
CAAATAAAAAGGACTTCTGAAAAAAGAAAAAACAACACGAGGCTCGAATGATGTAATTTT
GTTACTTTTCATTTTACTTGTTGACTGTTTAGGGTGCACACTGGTTTCTTTCCCCCCTTT
TTGTTTCTTAAGCCCTGTTTTATGGTCTCAGAGAAAAAATATGATATGATTTTTAATTAC
ACAAAGTAGTTCCTCAGGAGGCTCCATCCCTGCTCGGGCATTCCCTACAGTAACCCGTTC
AGGCTACCTGCAATTTGATGTAGCTCTCAGGAGCACGCCATCAGACATCTGGGTCTGTAG
GAACTCTTATCCTTTTTGGAAGGGGGTGGGGTTCTAGAGGCGAGGGGACTGAGCAATAAG
GCACGAGCTTAAAAGCGGTTGGTCTCATTGCCGCACGACTATGCCCTAAGTGCTGTTGAG
TGGCTTCCAGCCACAGCGACCCCGAGCACGACACCGACACCGCGGTCGGGGCCATCCTCA
CAGTCCCTGCTGTGAGCCCGTCGCTGCAGCCCCGGAGCCAGTCCACCTCTCCGGGCCCTT
CCTCCTCTTAGCTGGCCCTCCACTTCACCACACATGGTCCTTCTCCAGAAACCGGCTCTT
CCTGAGAACCGGCCCACAGGACTTTCCAATGCCTTTCTGGAATCTGGACTTCCTCCAGCA
TGACAGGTGGGCGACTTTGTTGTGCAGGTGCTGGCATGAAGTATACTTATTTTCTAAAGC
ACCGTGTGTTTTTGTTTTGTTTTGTTTTACCAAACTGGTAAAGCAGAGGACTGCCATTGT
TGCCTGGTCTTGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved