Echinops_telfairi Locus Mono:307:SNORD86
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:307:SNORD86
Echinops_telfairi
Mono:307:SNORD86
scaffold_165710
SNORD86
1001..1086
2086
TACTTTAAGATCCATTTTAAATTTGTCTTAGTTTTTATTATTTTCTGATTTCCTTGGAA
TAGGGGTTTTCTGTGTTATATTTTATGTTCATGTTTTTTTAATATGATTTTCTTTAAATT
AAATACGTGATAGGTAAATCTATACATACAGTAGCTAAATTAATAGTTTCTTAGGGTTAT
TGCAGGGAAAGTTAGGCGGGGATGGTGAGCATCTAAATAACAGTGAGTCCAAAAATGAAG
AAAATGTTCTAAAATTGATTGTGGTGATGATTGCACAATTATTTTTAATATATTGAATGC
ATTGAATTGTATGGTACATTAATTTTATATCTTTAAATTTGTTAAAATAGCTATTGAAGG
GTAAGGCTGGAGAAAGTTGAAATTTATGGTTTAAACTAATACACAGTTGATTCTTTGAAA
TGTAAACACACATAATTTACAGTAAATATAAGAAAAATAAAATATTTTAATTGATTTATG
AATGATAAATAACAAGTGGTATTTAATGGCACATTTTTATTCTGCTATTGTAGATGAAAT
CACATGAAAATCTAAAACCAATCATACTACCTGTTATAAAATATCACAATATTTAAAATA
TAATTCATAGAAAACCCTAATAGCAAAAAAATTAATCTTTTTAAAAAGGGGTTTTCATTT
CCAAAGGAACAAAATTATCTTTCTGGGGGGAAAGTATAGCCAGAATGCTCCCTAGAAATG
AGGATAGTGGGACTTTGTTCGGGTAGTTTAGACCTAGTACCAGGAGAGACCAGTCCCGGG
AAAAGGACATCATGCTGAGTACAGTTGCGGAGCAACAAAAGAGGTGTTCGGCTGTACAGA
GGGTCACTGTGAATCACAACCAACTTGATGGCACCTCACAACATATAATGACAAAATATG
GATACTAATATAATTTTTAAGTGGCTTGAAAAATAGTGATTTAGATTAGAACCACTAGTT
TAGGTTTTTTTTCTTTTTTTAATTTGATAAAATTATACAGATATCACAGTGATGGCTGAC
CAGGGCCCCTGACCCATACAGGCCTCTGCTATGGGAGTGATGGGCCAGCCCTGGTGTCTG
AGTGATTCCTAGGGCCCAGCAAAAGGGACCCAGCTTCCAGAGCCCTGAAGACCCGGGGAA
ACACCCCTAAATACGGACTCATTTTTCACTCCACCTTCACTGGCCGAGCAGCTGCCAAGA
ACAAAGGCCGTATCTCCGGACACCTGGCAAACAAATGCAGCATTGCCTCTCGGATCGATT
GTTTCTCGGAGGTGCCCACACGCGTATTTGGGGAAAAGCTTCGCGAGCAAGTCGAAGAGC
GACTCTCCTTCCACGCGACTGGGGAGGCGCCTCGGAAGAATCTGCATGGGATGAAGGAGG
CAATGGTTCAGGCGGAGGCGGCCAGATGACTAGGAAGCTGGAGAAGCAGGAGAAGAAACG
CTTGAAAAAGAAGCGACTGGCTGCGCTTGCGCTTGTGTCTCAGGAACACAGCAATGCTCC
TGAGGAGTGAAGTGAGGTTGCAGGAGACAAATGGGGAGTGGCCCAAAAGAAGAACCAGCA
GACGGCCCAGGAGGCTGCACAGGAAAATGAAGTGGGAGGCCCAGCTATCTCTGCCCTCCC
CAAACCCAAGAAAAAGAGATCTAAGAAGGAGATGGTCATCAGGGATCCAGAAGGACGCCC
CTCCCCAGAGGAAGAAACGGAAATCTCTCCCCAGAGAGGAGCCTGCATGTGATCCTCAAA
AGGCAGCAAAGGGCGGGAGCATCCCAAAGAAAAGGAAGAAGCTCCCCGCGAAGGGGGAGC
CCGCCAGCAGTGGACCCTAGGAGGCAGCTGCTAGCAGCAAGAGCAACAGCACTAAGAAAA
AGAAAAAAAATTTTTAAAACAGCCCAGGAAGATTAAAATGGACATTCCCTGGTGCACCCC
AGCCCTCTCAATAAAGAAACAACACAACAAAATAACAAACAAACAAAAATACAGATAACT
CTGTTGGTTTGGGTAGTTGACCTAGGCATTCTCATTCCTGAAGTTTATTTCATGTCTTCG
TACTCCCTGTGTTAGTCTGGGTAGACTAGGGAAACAAATCCACAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved