Echinops_telfairi Locus Mono:154:SNORA4
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:154:SNORA4
Echinops_telfairi
Mono:154:SNORA4
scaffold_233627
SNORA4
1001..1143
2143
GTCTCCAGGTTCCAGCCTTTAGGGCCCTTGGCTGAGAGGCGTGGTCGATGGTACTGGTT
GCATTGGCTGGATTAAGCCCACCTGGCCTAGTTTGGGCCCACCCCCTGGTTCCTGTTTCT
AGCTACCTAACAATTTGTTCTTGATCAATAAGAAAAGAAAGTGTTTTTTTTCCTTTGTGC
ATTTCATAGGGTTTTATGTTATACTTGTTAAAACATTGAACTGACTCGTCTTTATTCTCT
TAGAATGGTTAGTCCTAATGGTCTTTCTTCAAAATTTGTCTCAATTCTTTGACAGTTTGA
TTAATTTTGTTCTACAAAAAACTTCAGAGAGAGTCACAGGAAGTTGAATAGAACATTAGT
AACAAATTCGAGTCTCCTGAAACTCTAATCTAGAGGGTCTACCCCAATACAGTTCCAATG
GTTGATATTGTCATTTATTCCTTAAAACCAGCTACTCTTCTCTTGACACGCATTACCTGT
GATTCTGTGAATTGGATGTTGTGGAGCCTGAGGCAAACTGCTGTGAGTAATTATAATATT
GCTGAGTGATGTGACATCTTCCAAGAGAGGCTATTTCTCACGGAAATTGTATGATTAGGT
CTCTAGGCATCTTGGCTTGTTCAGGGAGTCGTGGTGGCCCTCTGGGGAGCTAATGTGTCT
TTAATTATTTACAGGTTCACTAGAGACCCTTTATAGCTATAAGCACAGCAGCTACGGGAA
TATTTAAAAACAATAGCATGAAATGTGTCCGAGGCAAAGTAAAAACGAAGACATTAGTAG
AAACTGATGCAGGCACAGAAGCTGCCAGCTCTAGTTAGCATCCCGGGCTTCTCTGTGTTG
GTTTGGAGTTGGCGATTGTATGTGCAATGACACAGGTTAGTCTCATTCTGAAATGTAGAA
GGCTTTTTACTCGCCTATATAGGAGGCTGGCAAAAAATCACATCTAAGATGGACTTTGAT
CTCTTTAAGCTTATAGCCAAATTTGCTTAAAAAAACATCTCCTACTCAAAGTTATTTTTT
GTGGCAAGGTTTTTTTTCAATAATCCCTACCAGTTTGGGCTATTTGGGAAAATAAAGAGA
AGGCCACACTCCCCAGTGGGCTATACCACTTAGTATAGTTCACTACTATTTTGTGGCCTA
CATTATTATATATTTTTTAAAAAGATAAATCATCTCCATGTATTAAATCAGAGTCTAAAA
TTACAAAACTATTTAGACAGCCTTACTATAAAACATAAGTATTTTTCCCAAACATAAGTA
TTTTTATACACATACACACAAATACAGATAGGTACATAGCTAGATAGATAGCCCATGAAG
GTATAAAAGTGGTTAATGTGCTCGACTTCTAAGCAAAAGTTTGAGGATTTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCACTCAATGACGAAAGCTG
GAAGCATTTACCCGGCATATGGGAACTAGACAAAGATGGCTGCCATCACCATTCAACATT
GTGCTGAAAGTGTTAGCCCAAACCATTAGACAATAAAAAGAAACCAAAGGAATACAATTG
GGCAAAGAAGAAGCAAAACTCTCACTATTTGTAGATGATGTGATTTTATACATAGAAAAT
CCCAAAGACTCAACAAAAAGATTGTTGGAAACAATAAGAAGGTTGAGCTATGTGGCAGGA
TACAAGATTAACAGCCCTAAATCCATCAGATTACTTTGTGCTAAGGAAGAGAGCTCTGAA
AAAGACATTAAGAAAATAGCTACTTAAATATAAAATACTTAGGAATAAATCTAACCAGAG
AAACAAAAGATGTACAAAGAAAACTACAGAATATTATTATAAGAAATCAAAAATACTGTA
CACAAATGGAAATTCTTTGTAAATAGGAAGACAATACTGTAAAACTGTCAATACTACCCA
AATCAATCTATAAATAAAATGCAATTTCTATCTAAATTCCAACTAATTTTTTAAAGAAAT
GGAAAACCTACTAACTATCTATGTATAGGGAAGAGGCCCAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved