Echinops_telfairi Locus Mono:565:SNORA57
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:565:SNORA57
Echinops_telfairi
Mono:565:SNORA57
GeneScaffold_1973
SNORA57
1001..1128
2128
GAGACGATACAGTTAGGGTACAATGTAGCAATGATGAAACATACAACTTTCCTGTAGTT
CCTAAATGCTTCCTCCCCACCACTATCATGATTCTACTTTACAAATACGGCTAGACCAGA
GGAAGTATACTGGTACAGACAGGAAACACAGGGAATCCAGAAAGATGAACCCCTCAGGAC
AGGTGCTGAGAGTGGCAATACCGGGAGGGTGGAGGGAAGGAGGGGTAGAAAGGGGGAACC
GATCACAAGGATCTACATATAAACTCTTCCCTGGGACAAGCAACAGAAAAGTGGGTGAAG
GGAGACATTGTTCAGTGTAAGACATGACAAAATAATAATAATTTAGAAATTATCAAGGGT
TCATGAAGGAGAAAAATGAGGAACTGATACCCAGGGCTCAAGTAGAAAGCAAACGTTTTG
AGAATTATGATGGCAACAAATGTACAAATGTGTTTGATACAATGAATGTATGTTTGGATT
ATGATAAGAGTTGTACAAACCCTTTTAATAAACTTCTTTTTCTAACTTGGAGTTAGTGAA
CTGGCTCTGCTGCTCCAGGGCACGAACCGTATTAGAGGTAATAGGGCTTTCAGCTCTGAT
ACAGATGTACAACCTCAGAAACCCACAGGAGCACTTCTAATCTTTCCTAGAGGGTTGCTA
TGTGTCAAAATCTACTTGAAGGCAATGAGTTTGGTTTGTTGGTTTGCTTAGCTTCTTCAT
TAAAGAACATAAGTTGAATTTTCTCATAAGATGCCATGACTCTACTTGAGAAAATGCAAT
ATTCCTATGATAAAATCTTCTGTTTTAATTTCTCATGGAAGAGTGTTAGTCCCATGTTTT
CATTAAAAACAGTCTCTATCAAGAATAGAGTCTTTGAATTGCCCTGTTCCATCTCCTCCC
TGACCAACCTACTGCCACTGAGTCAATTCCAACTTACACAGACCCCACAGGGTGAAACAA
ACTGCTCTCCAGGGTTTCCAAGGATAAAAACATGAATATCATTTTTTTTTTTTGAATATC
GTTTTTATGTACGGAGGCAGAGGGAGCAGGCTCTGGTCCCCTCGGGGCTATGTCTTCGGT
GCCAGGAGCTACCCATCCACTGGTTCTATCCTCAAATGCCAAGACAAGGACCCGGGGGTG
GGGGATCATTTTATTGGGGGCTTGTACAACTCTTATCACAACCCATACCAAGGATAAAAA
TCTTTACAGAAGAAAGCTTCTCTCCTGCAGAGCAGCATAGGGGTTCAAACTGCGGACTTT
AAGACTCCTAGCCTAACTTGTAACCAATTAGACTCCTAGCCCAACTTGTAACCAATTAGA
CTCCTAGCCCAATTTGTAATCAATTAGGCCAAGAAGACTCCTCTCTCATTGGCAACAAAT
CTGAAACAAAGCTTTGACAAGTTTTCATAACTAAATTTCTGAAACGCCTTTTCAAAGGAA
TAATGAATACTTATAAATTCACCTAGTCCTAATAAAATAGTATCGGAATGGCAGCTCTTT
AGAATGAAGGGATTATACATATGCATGTGTATGTACATGTGTGTGTGTATTATTCTCCGT
TTCTTGTCTTGAAATGTCTACAAATGATTTTACTGTGTTTGGCTACAGACCCTTTTATTA
TGCTTGAGATAGTTCGTAGAAAAAGCTGCAGACCAAAACAAATCCAGGAGTTTTACATTG
GAATTAGAGAACTCTAGCAGAAGAACAGACTCAGAGAGCCCCTGGAAGGAGGAGTTAGGA
ACCAAGTGGCATTCACGGTGAAGTTCATAGAGGTTAGGGAAATGGAGGAATGGAAACAGA
AAGCACAGGGATGATGTAGGATGAGTGGTGCCACACTGAGCAAGGATTGACACGAATGAG
ATGAAACATTGTGTATGAATTGTGGGACGTAAAATGATGTTCTGCTATAGCCTTCCCCTA
AATCACATACACACAAAAGTTTTAAAAACAAAGAAAATTAATCGCTTGAGGGGGAGGTAT
CTGGTTTGATAACAAATCAGTGTCACTAAACTAAGAAGCAATAGCTGTGGATGTAATAAA
GATAAGACGAAAAGAGATAAGAAAAGAATAAATAAAAATGTTTTGTTAGGTATTAATGTG
TTTGGTCAAGAAAAGAAGAGTAATTGATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved