Echinops_telfairi Locus Mono:488:SNORA5
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:488:SNORA5
Echinops_telfairi
Mono:488:SNORA5
scaffold_201980
SNORA5
1001..1139
1374
ACCCTCAAAGAATGAGCAAGTGTATTGTTATGATGGATAACATTTTTTTCTTGGCACAA
TTTTCTTGACCTTTCTCCCAACAATGCAGTTTTCCATTTTCTCAAAATTGCTTCAAAGTA
AGCTCCTGGCTACCACTATCAATTGCTCTGAAAGTAATCACATGAGAAGGTCTTAGTTGA
AAATAGGGGTGGCGGGGGAAATGGAACAAACTCAGGCTTACTGTTCAGATAGAAATTAGT
AGAACCCCCAAGACTATGGCCCTTAATCACCTTTCCAGCCTAGAAATGAACTCATTCCTG
TGGTTCAATTTTCACCCATATAATAGGTCTATAAGAAAGCAATAAGGCTAGGGAGGTATA
GAGGTCTTAGAACAATCAACCTATTGGAGACCGAAGGACGATATTTGTCAAGAAGAAAAG
TCAGAAATGTTAGGAAAGGAGGAGAAATGGGAACAGGAGACACAGGAAGGAAGCAGGATG
TTTCATTAAGGAGACTGCACCCAATGGCAGGAAACAAAATGTGTGTCAATGGTTGAATGG
AAAATTGGGCTGCTTTGTTAAGCTTCATGCAATTCACAGATTAAGAGGTGTTGAAACAAT
TTGGTATCCATAGCTCTAAAATTTAACTTCTCTTAACCTTAATACCTTCTACAAAAATTA
GTTCAAAATAAATCATATTTTCAGACAATATGTTTTAGAATATTACTAGGAGAAATTTTT
CAGAATGTAGGGCTAGGACAGGGTTCTTAGACTCAATGCTTAAAACAATACATAAAATGG
AAAACTGATAAGTTGGGCTTTATCAAAATTCAAAACTTTTGTTCTGTAAAAGACCCTGTC
TCTCTCACACACACACAAACACATACCCACACACAAACCAACAAAAAGACAGTTTGGAGA
CTGATTATGGAATCAATTGTACAATTCTGTTTGAAGTGATTGAACTATGGAATGGTATGG
CCTATGTATGACTCTCAAGTTCCAGCAAAATAAAATTTTTAAGAAGTGTAGATCCATTCG
GTGCCTGCCTTACCCATGGGAGGCACTGACCCAAAAGGCTGCCACAGCGACATTGTAACT
CATGGGCCCTGTTCCTTCCTCTCTGCTGACCCTCAGGGATAAATTTTGTTACAGACATTT
AAAAAAAAAGTGTAGATCCATAATGGGTTTTGGGCTTGCACTAAAACCTAGCTCCAAAGT
GAACACAATTAGGTCCTACATCATGGTCCTGCTCAATACTCTGCTCTCAGATAAGTGAAC
ACAGAAGGATACGAGATGCTATAGCTATATAGGAGCAAAGTAATGTAGATGGTTGCCAGT
CTATCAGATAAAATAGGCATCTTGCGGTCTTAAATGGCTTGTCTCAAAAAAGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved