Echinops_telfairi Locus Mono:86:SNORA31
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:86:SNORA31
Echinops_telfairi
Mono:86:SNORA31
scaffold_256903
SNORA31
1001..1131
2131
CTAAAACAGCATAACCTCACAACATCCAAAGGAGAAACAATTTATCCCAAAATATGACT
GTGTGTTTGAAATGACTTAAACGTATCCCTTAAAACAGTAATATGTATAAAATATAATTA
TCTATAAGAATGCACCATCACATAAAGTATGTCAGGGCTTCAAAAATGTTTATGGAAAAT
GAAACTGAAAGATGAGGATATTTTCTAAAACCTTTTTTGAAATCCCCAACTATATCTAAT
ATAAGGTCATATCCCATCTGTATTCTTGAAAATGGGAAAATCTGACTAAAAACCAGAGTG
TATAATAAAAATAAAGGAAAGATTTAAAAAGCATTTCTAAACCTATTGGAAAATTGCAAG
AGCCCTAATAAAATCAACAACAGTATTAAATATAAAAATCATTAAAATTAACTCTCCATT
TACATTTTCACTTAGAATTATCATAAGCCCATCATTACATCTATTAATTCCTTGTAAGTC
CTCAGAGTTACAGGACTTTGGCATATTCATTTCTGATGGAAATCAGTTTCATAAAAAAAT
GTGTATAGGACTGAAGGGTGGTGTTGTCCAACAGTTAGGTTATTAACACAGAGGAAAAAT
GCCTGTGCAGCATCTTTATCTGCTTCCACAGACATTTAACAGTCTGAAAATTGATGATGA
AAAATCATCATTTTAGGGCCTTAACTTCAAGAATGTCTGTAATTTATCCGAAGACCTTTA
TATATTGTTGATATTATTGAAGTTCAAATATCCAACATAGACTCACTGCCATGGAGTCGA
TTCTGATTTATAGCCACCTTATGGCCCAGGGAAGAATGGCCCTGCAACTCCTTATGGAAG
TCTGTGCCATCAAACTGATTCAGATTCATAGTAATACAAGGAGGCACTACCCTGTACAGC
ACCATGCTGCAATGCCTTTGTATAGTAAATAAAACTCAAGAAAATATTGTAGTGGTGGTG
GTTCTCTGCTCTCAGCTAAGATTTAACTGATGTCAGCAAGAACATCCTCTGATAGACCTG
GGACAATTGACCATTGTTCTTCTGGTTTGCACTAGGATGAGAAAGAATACAAAATCCCTG
TGCTTTCTGCCTGTCTTTGTGGAGGCTTCAAATTGAATGAGGGATTACATAGCAAAACAG
AAACAAACAAACAAAAAAACTGATGTCAGCAATCATATCCCCAATTCTCCTTCTTTTATA
GAATCCAACTGGAGCTTCTGGTCTTATCAATTTATTGCTGCAAACTTTTATGAGAGTCTT
TTAACAAAATAGTACTGGGGTAATTGCCTAGGATAATAATGATGCTGCATTTTGTTGGCA
ACTTTATTTGCAAAGGGAAAAAATACAGACCACTTTCTGTCAACCATCCAATAGCTATTA
TCAAAATTTCTTGGCATATATGAATGAGCACTTCCAGGATTGTATCTTCTTGAGAAACAT
CACAAGTGTTATTCTGATACTTAATTCTCAGTGCAGCTTAGACTTCCTCCTTTGGTATTC
CTTTAGTTCTTTGGTTCATTTAATACCTCTTTTGTTGATAGTTTATTTCTGATTTGGAGA
AGAATCAAAGATATCCCTTCATATAGATAACATGTTGAGGTAATTTATATCTGAAACAAA
ACACTTCTACAAACTAACTTTATTCTTCCTAAATTATTGTCTTAGACAGAATTCTCTGTT
GTTCTGCCATTAATCGGTGCCATTGAGTCAACTCAAACTAACTGTAATCCAATAACCAAA
GTATGAAATATCGCCCAGGTCTACACCATTCTTAAGATTATTGCAATCTTGAGTCCATCA
GTGCAGTCACTGTGCTTATCAATGCCATGTAAGGTCTTCCACTCTTTCATACACGTCATC
AAGCACAACTTTCTTCTTCGAGAAATGACCTGTCCTGATAATATCTCCAAAGTACATGAG
AAAAATCTTGCTGCGCTACTTCTAATGATCATTCTTTCTGTACTTCCATTATGGATTTAT
TCTTGATTCTAGTATTTAATGATATATTCAGTGTTCTTTACATTTCAAATGCATTCGTTC
TTCTTTTTATTTTATTTTAATTCGTTGTCTGGCTTATACCTGCAAATGAATGATGGAAAA
CACCATCAACCTCAACGTGACCACTTGGCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved