Echinops_telfairi Locus Mono:188:SNORA70
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:188:SNORA70
Echinops_telfairi
Mono:188:SNORA70
scaffold_184424
SNORA70
1001..1131
1617
CCAGCAGCACCTCAAAGAAGCCCTGCTGATCTGCCAAAAAAGCAGCCTGTGAAAATCCC
ATGGAGAGTCCATCATACCCCTCGGACAAGCAGACTTCCTCCCACCCCCTTTTTGCATGA
GTTAGAAATCGCTTATCTATTCACATCTACACATTTGTAATCTCTGTCCTTTGATCCCAG
TTCTGCGTTCTAAAACAACCATTGGGATGAAATCTCCTCTCTCTTCTCCCAACAGATCTT
AGCACTTCTCAGCGCTCAGCTTTAGTTTGCCTCTGACTATAGTGATCCATGGTTGGTCAG
ATACCGTTCCTCCTTGTGATTCCACATGGGGAGGAACTAGATATGAAGAGGGGACATGAC
AGTCCCTAACCTTGTGGTGCAGTGATTACACGTTGGGCTGCGATCGCAAGGTCAATAGTT
CAAAATCACCAGCCACTCTGAGGGAAAAAGATGAGGCTTTGTGCTCCCATCAAAAAGTAT
AGTGTGTCTGCAGCCAATTAAGCCGACCGTCCTCCTTGTGGGGGCTGATGTGCAATAGCT
GCAAACAGCAAGCCTCCTCGGTAGTGTATGCAGCCTATTGGTATGTATAAGCTGCCCTAA
GGGACCTTGGAGACAACCTTTTGCTGCTTTTCAATGCCTCTGGCCTGGCTAATTTCTGCT
CTCCCTAAACTAGGCTCCAAACTGGGATGCGAAGTGCTTTTGGGAAACCTCAAGGCACAG
TGGCTAGAGTCCACATTGGCCAGGTTATCATGTCCATCCGCACCAAGCTTCAAAACAAGG
AGCATGTGATTGAGGCCTTACGCAGAGCCAAGTTCAAGTTCCCTGGGCGCCAGAAGATCC
ACATCTCCAAGAAGTGGGGCTTCACCAAGTTTAATGCTGATGAGTTTGAGGATACGGTGG
CTGAGAAGCGCCTCATCCCGGATGGCTGTGGAGTCAAATACATCCCTCACCGTGGCCCCT
TGGACAAGTGGCGGGCTCTGCATTCATGAAGGCCTTGGTAGCCCTGTGCTGCCTCACTTG
TACCCAACAAATAAAAATTGAACTTCCTGAAAAAAAAAAAAAAGTATAGTGTGAGAAACC
CACAGGCAGTTCTTTTTAAAAAAATCATTTTATTGGGGGCTCGTACAACTCTTATCACAA
TCCATCCATCCATTGGTCAAGAACATATGTACATTTGTTGCCATCATCATTCTGAAATAT
TTTCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved