Echinops_telfairi Locus Mono:238:SNORA63
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:238:SNORA63
Echinops_telfairi
Mono:238:SNORA63
scaffold_200740
SNORA63
1001..1110
1260
TTCGCGGAATTTCATTTATCACGGTAGGGTCTAGAACCGATTAGCCGCGATAAACGAGG
GTTCACTCGTTTATACTCGAGTATAAGCTGACCCCAAATTTTCAAACTACAGTTTTCAAA
TTTTTAGTTTGAAAATTTCAGGTTGGCTTATACTCAAGTATATATGGTATCTGTTTAGTG
GTATTTTGTCGTTCCTCCTGCTCAAAATAAAGTTGTTGTTTTTCTATCCCTGTTTGCCCA
GAGACGCTTGAGCTCATACATGTTGAAAAAATAAATATACATATATAAAATATTGAAAAC
ATGTAGTTATATATAAATTTGAATGATATCACCTCTTGTAGACGTTGTGGATAGTCAGGA
TGGGCTAAGACAGTGGTTCTCAACTTTCTTAAGCGACCCTTTAATACAGTACCTCATGTT
GTGGTGACCCCATAACCATAAAATTCTTTTTGTTGCTACTTCGTGACTGTCATTTTGCTA
CTGTTATGAATACGGCCACTCCCATGAAAGGGTTGTTCGACCCCCAGGTTGAGAACCACT
GGTCTAAGAGGTGGCAGGCAGTGTTGGGATTTAAGCTTGTGTGGGCGTGGGTTAGAAAAC
TGGCTTACCACTTAATGGCTTGTGGTTGCATAAAGTTATGTAACTTTTTTGAGCATTCAT
GTTCACAAAATTGACATGTAAACTGGCTCCTTTTATGTATTGTGGCGTTTGGAAGCTGCT
ATTGTAATTATTAGAAATGTTAAAAGCGTGGCTTTGATTATAAAACATACGGTCTTCACA
ATGTTGGCTTTCAAATATGTCTCAGGCATTTTGATTCCTGTGTTATTTGAAAAATAAAAG
TTTTTAGAAATCTAAGCCGGTTTCTTTAGTGCAGGATGACCAACACTTTGACCATTCTTG
CATGTTTATTTTATTTTCTTTGGTGATGAATCGCTTCTTTATGAAGACATTTCCCCATCG
CGGTTACTACAGACTACTATCTATCTGCTGTGCCATCTTCAAGCTAACAGTTGGGGCAAG
AGAATAAATGCAGACAGCACAGCGAATCCCACGTAACACAAACTACTATACAAACCAAGA
CCTGTCTACAAATGAAAAATCTCTTCTGGTTGCCAGTTAAATACAGTTTTAATTTCAGAG
CGTAACAATTAAGGATCATACACTGAAGTCAATACCTATACACCTACTATTTTGGGCTAA
GCTAGTCCATATGCACAGCTGAAAACAATTACAAGGTATGGCCCAACAAACACTGGGGGG
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved