Echinops_telfairi Locus Mono:556:SNORA46
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:556:SNORA46
Echinops_telfairi
Mono:556:SNORA46
GeneScaffold_2670
SNORA46
1001..1139
2139
TGATGACAGTGGGCTGTTAGTAAGAATAAGTCAACAACGTGATTTACTTTTTAGTATGG
TATATACTCGAGTATATAAGCCGACCCGAATATCAGCCAAGGTACCTAATTTTACCACAA
AAACTGCATTAAAAATGTGCTGAAAAACCTGGCTTATACAAGTATATATGGTATCTGTAT
TTGAAAATACAAATAATTATTTAAATGGCTTAAAATTAAAGAATTATTAAAAGCACATTT
CTACTATAAGTCTGTATATTTTAATGCATACAAAATCAAAGCTATGAACATGAAGAATTA
TTTTAATTTTAGGTATTTGCTAAATGTTTTTACAATCAGTATATAAAATCTGCTCTAATA
ATTATTTAAAACAACTCATGTCTTTGACTTTTGGGGTATTTTGTATCAAGTAATTATAAA
ACATTAACATTTGATGAGTAAGGTTTTAATTTCACATTAAATTTCCATTTTCAAAGGTAT
CACAGGAAATATGAGTGCTTTTCAATGACGCTTTGCCCTCTTCCCCCTCTGCTTGCTAAT
TATAAATAAGCCTCAAGGCTCTAGGTTTACACTCCTCTTAGCGAGCTCAGCACCTCTCTT
GGCTTTGTTTCTTCCATATTTGAGCCTTCAAATATTCCTCTCATGCCTGACCATTCAAGG
TTACTGAATATGTGGGAAGTGAGGGAAAGAGAAGAATCCAGGTGATTTCTAGGTCCTTCT
ATCTTGAGCAACCTAGAGAACATTTACTTAAACTCGGCACCATCCAGTGGAGGCCGACTC
CCAGCGACCCCAGGGGACGGGGAAGAACTGCCCTGGTGGCTTTCCAGGACTTTAACTCCT
TACAGTAGTAGCCAGCCTAGTTCTCTCCCTCGGAGCGGCTGGTGGCTTGCAACTCCTGAC
CTTACCATTTACTTCGATGGAGAAAAAGGAGAGAAAACATCTGCTAGGAAGCTGTAGGAG
GATGCCTGGGATAGAGATGTTCCACAGAAATTTAAGAGGACAACGCTATACTTAAACCAA
TGGATGGGCATTTTCCCCATTCTCGGTTACGCTGTAGTGCTAACCAATTTCCCTGGCTCT
CCGTCCCCAGGCACCGCTGACTGCCAGTTGGCTGTTGCTTTGTGCAGTGAAGGAACACAG
TTGTAAAAAATAATAATTAAAAATGTTAAATATAAAGAAATTTAAGTGACGATGTCGCCT
AAGTCTCTGAGCATGATTTAGAGTGCTACAGAGGACAGGGCACAGTGGGGTACAGAATGT
GGTTGCCTTCCTACTTTCCTGTTAGCATTTACTTTTTATAATAGAAACTGAGCATAATTT
AACATCTACTACTAATACACACTGTATTAAGACCCAAACTTAAACCCAGTGCGACTGAGT
CAATTCGGACTCATAGTGACAGTGTAGTACGGAGAAGAACTCCTTAGGACTGCAGAGACT
GCCAATCTTTAGGGGAGCAGACAGCCTCATCTTTCTCCCAAGCTGTGGCCGGTGGATTCA
AACTGATGCATAACCTACAACACCACCAGGGCTCCTTACTGTATTAAGAAGTCATTAAAA
TGTGTGATTTTTACAAAGAAATGACATTGTGTTCATAGTTCCCAAGGCTCTTTGATGGAT
CTCAGCCCATTTGCTTCCTCAGAAATGTTGTATTTTTTAATTATATTTCTTTCTTTCTCC
TATATAAGTTTCCCCCACTATCCAAAAGTAGTGTTCCTATAAAACCTTTCACAGGGCAAA
ATGGTGAAGCAAAAAAGCAACGAGGAACTTCTAAGGAAAGAAATGTTAGGATCCCTAAAC
CCCACACCAAATCATAGCAAATACCACATAAAACCTAAAATAACACTAACATGTGATGCT
CACAGGCACAGTTCAAAGCTATGGCAACTGGATACCAAGCATCCTCCAGGCAAGAAGCCT
GGCAGTGCCCCTGGCACTGCTCGGGAGGGGCCCGCAGCCTCTTGAACGGCTGCAAAACAC
CCGCTGAACACTAGTTTTTTGTCACCTCTTCTCTTCATAGGGAAAACCCTCTTCAGATTG
TTTCAGGTGGCAAAACCAGGTACTAAAGTAGGTTTTGAATAAAACTGAAATGGTGGGTTT
TTGGAACGTGGGGGACCCTTAGATATTTACCTCTCCTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved