Echinops_telfairi Locus Mono:412:SNORA33
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:412:SNORA33
Echinops_telfairi
Mono:412:SNORA33
scaffold_70948
SNORA33
1001..1125
1337
TGGCAAGTACTCCTTCTGAGGTGAAATAATTAATACAAAGATGGTTTGTTTTCTGGTTT
GAATTTGAAATGCTCTGAGGGGTATAGCAATGCATCTTTCAAATTGAATTTGGCCCATAT
CAAAAAGTAACCTAGCAAAAAAGAATTTCGTTTTCCTTTAATTTTGGGGGAAAAAAACCT
AAACATTTAGCATTCCTTCTTGTTTACTAAAAAAAATAAGATTAAGAAACTATTAAGTCT
CTGCAGAAATTTAGAAAAAGCTGGCAATAACAGTAAAGCCATGTTATGAGCCTTAAGGAT
AATTGAGATCATTAAGGAGGCTGAAAGTGGCTACATAAAAAAAAAAGAAAACAAACTATT
AAGTCATATTTTAATTACATTATCCATAAAATAGAATTCTGTGCGCCTTTCAATCTCATA
TTTAGGAAGAGTTTTATTAATGTAGGAGCCCTGGTGACATAAAGGTTATGAGTTCGCTGT
CCACCCTCAAGGTCAGCAGTTCAAATCCACTAACCATTGCCAGGAGGAAAGATTATGCTT
TCTACTCCCATAGAGTTACAGTCTTGGAAACTCACAGAGGCAGTTCTGCCCTGTTCTACA
GAGTTGCTATGAGTGGCATTGACTCAATGGCAATGAGAAAGAGATATTATCGATAGGAGA
AAATGTTCGCGGTACATCATAATTTTTTTAAATTGCAGGCTAACAAGATTGTCTATGATA
ATAATCATAACATGAATATTTTTGGTTCCCTTGTAACAGGCACTGTGCTGATGTGTTTTG
TGCATTTTGTTATTCATATCCCAAACATTCCTGACACAGAACGGAGCTGCTCCACAGGGT
TTCCAAGGCTCTAGATCTTTCCAGAAACAACAGATGACTGCTTCTTTCTCAGAGGGAGGG
AAGGGCTGGTGGGTCTGAACCACGGACTTTTCGACTAGCAGCTGAGCACCTTAACCACTG
AACGAAGGGTTTCTTCAGCTAAGTAAAACGAAGCAATGACTTATTCAGCTGTGATTAGAC
TCCAGCTATATCTGACCATAATGATTAGGCTTTTTAAAAAATCCGTTTATTGATGGCTCT
TACAGCTCTTATCACAATCCACTCATCCATGTATTGTGTCATGCACATTTGTACATATGT
TGCCATCATCGTTTTCAAAACATTTTCTTTCTGCCTGAACCCTTGCTATCAGCTCATCTC
CCCCCCCCCTCATGAACCCGTGATAATTTATAATTTGTTTTCATGTCTCACACCAACTGC
TATCTCCCTTCACCCATTTCTCTATTGTCTGTCCTCCTGGGAGGGGATTATATGTAGATC
ATTGTGATCGGCTCCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved