Echinops_telfairi Locus Mono:224:SNORA5
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:224:SNORA5
Echinops_telfairi
Mono:224:SNORA5
scaffold_284921
SNORA5
1001..1136
1841
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTCTCCTCTCCTCTTCTCTCCTCTCCCAATGTGGA
CCACCAAGTGAGGCTGAGGTGAGCATGCTACCATGAAATGTGTCTGACTCCATTATTTCT
ATCTCTCTTCTATCTCTCATGCTCTCTATAACTTTACTATAATCTTTACTTATCGCTGTA
CAATTGCACCTACCGGACCCATGATGATGTGTTAGAGCGGGTACCCTGACAATCAACCTC
AACTTCTTTATGCATCAGTGATGAAAATGAGGGTGATTCACCCAAGGTCACACAGTATAT
AATGAAAAATCCCTTACTTTTTAGGCTATGCCCCCCTATTGTACAAATATTAACAGATTC
CTTTTGGAGTCCTGGGTTTCGGAGGTTGGGAAGGGGGAAGAAACTGCTTTTAAGACTAGA
TTTCCTATTTCTAAAATACTGAGTATTTTTGCATACTGTGTGTTGCACCAAGGGTGAGGC
CTACCGGTGAGTGCACCAGGTGTCATTCTCCACTCACACTTAATAGTGATTATTGCTTTT
GTTTTTAACTTCACAGCATAATAAACCTTTTATTTTCTTCTAATAAGGGTCATCCTGGTG
GTGAAGTGGTTACATGTTGGGCTGTCAATCGCAAGGTCAGCAGTTCAACTCCACAAGTTG
TTCCACAGGTGAAAGATGAGGCTTTCTGCTCCACTAAAGGTTTACAGCCTCGGAAACCTA
TAGGAGCAGTTGTACTCTGTCCTACAGAGTCACTGTGAGTCTAAATTAACTTGATGGCAG
TGGGTTTGGTTGCGGGGAAGAGGGGTGGCATTTTGGGTGCCACAAACCATTTGTTCTTGA
CTATTAACAACAAAGGAGCCTTTAGGGAATAGTGGTTAGACTGCAGCTGTGTCAAATTCA
GTGCCTGCCTTACCCATGGCAGGCAATGGCCCAAAAGGCTACCACAGAGACACTGTAACT
CATGGGCCCTGTTCCTCTCTGCTGAGGCTCAGGGATAAATTTTTGTTACAGACATGAAGA
AAAAAGAAAAAGAAAAGTAGTGGTTAGATGCTGAGCTGCTAACCACAAGGTCAGCAGTTC
ATAACCACCACCCCAATCTGCAGGAGAAAAATGTGGCTGGCTCTCTACTCACTAAAGAGT
GACCATCTGGGAAACCCACAGGGGCAGTTCTACTCTGTCCTATAGGGTTGCTACGAATTG
GAACTGACTTGATGGCAATGAATTTGACTTAGTAACAACAGAAAGTTGGCAGTTTGAACC
AATCTTTGTTGCACCGTGGAAGAAAGACCTGACAATCTGCTTCTATGAAGATTATATCCA
ATAAAACCCTTTAAAGAAGCTCTTCTCTGTAACACGTGGGGTGACTATGAGTCTAAATTG
GATCCAAATTAACTTGTCTGCAACAGGGTTGGTTTCCTTGGCATGTGGGGTTGCAGTCTT
AGTACTCTCAGTGCTGCTATAGCAGAAATACCACAAAAGGGTGGCTTTAACAAACAGAAA
CTTATTTTCCTACCATTAGGTGGTTAGAAGTCCAAATGAGGCTACCAAACCTAGAGGAGG
CTTTCTCTGCTCGGTTAGCGCCGGAGGAAGATCCTCATCTCATTTGAGCTTTCCACTCCT
GAGCTTCCGCTTCCACTTGGTCAAGTGGCTTAGCCACCATCCTTCTCAATTCCGCTTGTT
TGTGGTTTGCCTAATCTGATTGCATCGCTCAAAATGATTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved