Echinops_telfairi Locus Mono:122:SNORA16
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:122:SNORA16
Echinops_telfairi
Mono:122:SNORA16
scaffold_166625
SNORA16
1001..1135
2135
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGACACATGTTACAGCCATTATGACAATGATTT
CCACCAAGGGTCTTCCTCTCCCTTGTGAGCCCCCACTTTACCAAGCATGCTTGTCTTCTA
TAGAGACCCGTCCGGCTGATTACATGATCAAAGGACAGAAGAGGAAGTCTTTCCATTCTT
GCCTCTAATAAGAATTCACATTGTACTTCTTCCAAGACAGATTTGTTCATTCTTCTGATA
GTCCATGACATAGTCAATATTCCTCAATAAGACCACAATTTAGGGGCCCTTATCGAAGCT
GCAGTTGCTTCCACGTAGCTGATGTAGTCAAAAAAGAGCCCACAGTGAGTTTTTCCCTTG
ATGGTCGCCGTTCGGTTTGCTGTAACCGATCTGCAACATTTCGGGAAAAGACATTGTCTT
ATCGTGTCAGCCATTCTAGTCGGAGTGAGTCCTTTGTTAAGACGGGCATGGGCTTGCGTG
TACTGTAAGCACAGTGAGGGCTGGGGAAAGTCACTGGTCTGAAGATGAAGCACACAGTAA
AGGCCGCCTTGTGTTGAAAGTGGAAACGTATTGTGCCTGGCCTCCAACCTTAGTCACTGA
GGAGCGGTCAGGTCATCCAGGACTGTTGTGTTCTGTTCTTGTCACAGCTGTGCTGAAGAT
CCCAGGATACCTGAAATTGGTGATCTCGGTGGAGGAAAAGTGAGACGGAGTGGAGCCATG
TGCCCTGGGACCTGGATTTCCTTGCTTTTCCTGGCTGTTAAAGAAATTTGAAGATGTAGC
TGTGCTGTTTAAAAATCTGAGTAGCAAAACAGCCCTGATGAAGCACAAAAGAATGGATTA
GAGCTTCAGCATTGAAGCACTATGGGAAGAACTTCAAGCAAGACATTTTATATGCAGAAA
AATTTAAATGTACCCGGCTTAATAAATAAAAAGACTGTGGGAGTGAAAAAAAAAAAAGAC
CACAATTTAAAGGCAACACTTATTCTTCAGTTTTCCTTATACATTGTCAAGCATTATAAT
GAGGTGATTAAAAATATCATGGTGTGGGTCAGGTGCTTCTTAGTTTTCAAACTGATGTCT
GTGTTGTCTAGCTAAACTAGGGAAACAAATCCACAGATACTCCTATGTATGAGATAATTT
TATATAAAGGGTAAGTGTACATTAAGAAAGCATCCCAACCCAGTGCTGTCCAAACCTATA
AGTCCAACATTAGCCTATATGTCCGACACTGATCTACAGAGTCCTCCTCAATCTCACAAA
ACACAATAAGTGATGCCGCCTGCAGGAGGAAAGCCGAATCAGTGAGCATGTAGGCATCTC
AGCACTGGCAGGGGTCTCCACAAGGTTGCTCCAGCACCCAGGGCTGCATCAGGGTAGGTC
CATGTGGCTTCTCCTCAGGGATGTCTTCCAGGAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved