Echinops_telfairi Locus Mono:620:SNORA8
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:620:SNORA8
Echinops_telfairi
Mono:620:SNORA8
GeneScaffold_4330
SNORA8
1001..1139
2139
GACCCATTAATTTAAGAATACAGTCCACATCAACCACAAAAATCCCTGCCCACTTTTAA
CTAAGCGAAGCTCTTTTCATCGGTAATACTCTTAACAGTTGCCCTTTTTTTAGCCCCACA
TTATTTTAAAGATGCCAATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGGGTATATCCATGACCCTCATAAGAAATAACCTATGAAGAGAGAAGAAAAACAGGCAG
TGGGTGACTTGAGGCGCGGAGAGAAGGATGTATGCATGTATTCAAAATTATAAATTCTTT
GCACATATTGCTCATGCCTAAAATAATTTTTGAAAGTGCTAAAGATTCACTTCAGAGATC
TTTCTGTTGGGTGAAATATTTATCATAATTTTTCTAAATGCTGTAGTATTCCCAAATACC
TATAACAGTTTCCAGCACTCAGCAACTGTTCAATAAATCTTAGGCGAGGTCTGGGAAGAC
CTGCCTGTTCCTTAGTCCAAGGAAGAAGCTAAGAGAAGAGAGCTAGTACTAAACATCGGC
CCTATGAAAAAGAGATGATCCAATTTGTAAATATAATTCTTACAATTAATGTCTACCAGC
CGAGAATGACAGCATAAGTTACTTTCTTTTTTAATTGAAATACAAAGTTATTGGGAGAAT
TCCAGCTTTGGGGGTAAGCTGTGCAGTCTGAAATGAGTAACTCTCAAACTCAACTTATTA
ATGCCACTTAAAGCAACATATTAAGATCATAAAGCAAAACAGCCCTTGGTAAAGAAACCT
ACTGAACTAATATAAACCACAGTTATTTTATGTACACCTTCTAAAATGAATACACACGTA
TAAAATACATCAATTAAAAATTTTAAGTCTCTGAAATATCATTTATTCCCCACAATTTTA
GAGAAAATATCAGGCTTTCGGTTGCCTATAAGAATATTGACAGCACTGCATGGTATCTGT
ATCCAGCAGCCTTTTCCTGCTGGGGTGTTCAAAGGACAGTGCAATAGAAATTCAGTATCT
GGCATCATTGGTTTTCTTGGCTTTGTGCATGTTAAACCTGGTATTTCTATTGATACAATT
CACATAATTCCTTTGAATGATAACCTGCTTGTTCATAAAATGTTAGGAACTAATTATTTT
CTTTTTGTAGGATATCTGAAATTGAGAGGAAGGCAGAATGAATGAGATCCAAAGATGTAT
GTAAAGCTTTCTATTAAAAAAAAAAAAAGGAATATTTTAGTGAATTTTACTTACATAACA
ATATATTGTGCAGTTTTAGCAGTGAGAACACCTAACTCCTTACTTATCAATTTAAGTAGG
TTCTAAAGATTAGGTCATTAGGTGAAAATTGACATTATTAAAAAATGGAGAATATGACCA
CATCAGATCACAAAATGGAAGATGACCATCACATTACATAACTACCAAACTACTAAAATC
ATAACCTTAACCATCATAGCCAGCACTACTCTAGACTAGTACTTCGGTGTTTGTTACTGC
CAGAAATATGTTGTCAATGCACAAAATACTCAAATAGAATATGTTTTACCATTGTCACAA
ATACAAAATGTCAGCTAATGTATAGGCTTGCTGACGTGGACTAGAGTGCAGAGAGCCTTC
AGACCAGACCTTAATGCAGAGTGGGGTGCCTCTCGGCATTTGTAGATGTAGTTAAAGAGC
TTGTGAAAGTCTTAGCAGGTCAGAGACGGGGCCAACAGATCAAGAAGCAAAGGGGCAGAA
AGTCAGCTAGAGACTTCTCTGTGGGCAGGGCTAAGAAGTTGTTTTTCTGACCAAAGAATT
GTGTCCTGAGTAATTTCTGATCCTGAATCATAATCTGTGACTTCAAGTAAAAACAGAACA
AAACATAATCCGGAGTACTATCTGTGAATTCTGGGTGGTCATTGCAACAGATTATCAAAG
CAGTAGAGTAGAGGGATTTGGGAGGAACACTAGGAAAAATGTTGGAGAGGAGGCACGTCC
TCCATCTTATAGAAATCCGTCTTGGGCCGTTGATCTTGATTCTCCTCCCATTTATAAAGT
CAGAGAAGATTAGATGCATCCACCATGCCACTCTTACATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved