Echinops_telfairi Locus Mono:299:SNORD57
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:299:SNORD57
Echinops_telfairi
Mono:299:SNORD57
scaffold_284314
SNORD57
1001..1054
2054
CCCCAAACCAAACTCACTGCCATGAGTCCATGCCGTCTCATAGCGACCCCGTGGGACTA
AACACAATCGCCCCTATGCATTTCTGAGCCCGTAACTGTGTACGGAGTAGAAAGTCCCCT
CTCCCGGAGGGCGGCTGGTGTTTTCCAACTGCTGAGCTTGAGGATCCAAACGTGGTATCA
CCAGGTGGCTAAGGACCATTAATTCCTGCCGCTTGGGGATTTAAAGCAAACAAGCTAACG
CAACAAATAATATCAAATCATATTTGTCTACAATATTAGAGCTAAAATTCTAAGCACTGT
TTGTGGAAGGCTGCAGTTTATGATGAACACCTTAAGGGCATTAAACTCAGCTTTCAGAGT
GTGAATCAGGCAGCTTTGCCCTCCGGCATGGGGTGTTGATTACCACACCCCAGTCAGCCA
GGGACCTGGGCAGGGCGGTCTTGCCCTCAGGGGATTTTCATGAGTGGGCCACTAATGGAA
GCTGCGATATCACAGCCTCATCGGCTTTTTGCTTCCGTAAAGATTTACAACCTCAGAAAC
CTTATAAAAGGTTACCAGGACTGAGTCGACCAGAAAGCAGTGGGTTTAGAATCATGATCG
TGAATTCTTTGGGTAGGATAACACTTCAAGCTGATGACCTCCCTCATCTGGGTTATCTCT
CTCTGCGCCCAGTTTAAGACGAATAACTTGAATCCAACCCCGGTCACCAAGTTAAAGCTA
CCCGTCCTACTGCTCTGAGTGAATTCCGACTGCTGTGTCAGGGTTCTGAGAAAGTACCGG
GAGCAGACAACCTCAGTTTCCTCCTGGACAAGTAGAAAGTTATGGAACATAGACTACTGT
CAGAGGAAATGGAGAGGGAGAGGAGAATCGAGGACATTTTTGGAGTTGGAATGCTAGAGT
CTGGAAACTGGAAAGTTAAATCCTGAAGAGTCAATTGACTTGCCAATGTGAATGTCATTG
ATTGACTTTGCCAGAGAAGTTTCCATATACAAGTTGAGTCAGGGAGTTGACCTTGTAAAG
TGAAGGCAAAAACACTGATTTAATTAGCCTGATCCAATAAGACAACCAGGAAGGAGGTTT
GGGGATAAAGAGGAGGTTCTGAACAGAGCTTGTTTAAGATTTCTCCCTGACCCAAAGCAC
TAGGAACCCATGGCAGCTCAGTAGACTACTAATTGGGCCACTAACCACAAGGTCAGCTCG
TCCACAGGAGAAAGATGAGACTGTTTATTTCCATAAAGAGTCTAGTAAACCCACAGGGGC
AGCTAGTTCTATTCTGCACTACAGGCTCATTAGGAGTTGGAATCAGCTCAGCGGAAGCTG
CTTTTGATCTTTGGCCAGGCAGAGGAGCCTGCGGTCCAGATTGCTGGGAAGCTGGAGACA
CAAGAGAAGCAATGCTCCAAGTGAGCTCAGGCCTTCAGAAAGCAGCAGTAGCACCCCCGA
GGAGTGTGAGGTCAGCGAGCAGGAGAGAGGTGAAAAACACAAAAGGAAGAAAAAGTGGAG
GCCCGATGGGGTTCCATCAGAAAATGAAATGGAAGACCCACCTAGCTCTGCTCTCTCCAA
ACCCAAGAAAAAGAAATCCTCTCCCAAGGAGGCCTGGGCCCTGGGCCCATTCATATCTGA
AAGTGAAATCCTCCGGTCGCTTCGGTACTTCATAAACGTCCCCTCCTAGATCGTCCCGGC
TCATAGCTTGCAATACCGCTCACATGATGATGGCATCTAGATTTTTCTTCCAGGTTTGTA
GACCCGACTCTCAATTCTGGATCTTCACTTGGATGTCTAATACAGAAAGTTACTAGACAA
ACATTTCAAAGCTCAGTTCATGATCTCCTCCACAGAGTCATGCTCATTCTGCTTCTCATA
GTGACACAAACGCATCAGCCAGTAGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCCCAGTAGTTACTTGAATTGAAAACATTAGTGGTATCCTTGATGCTTCTC
CTTTTGTCATCGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved