Echinops_telfairi Locus Mono:185:SNORD56
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:185:SNORD56
Echinops_telfairi
Mono:185:SNORD56
scaffold_276126
SNORD56
1001..1072
2072
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGCTGACTGCGGGAAGAAA
GCCGAATCAGTGAGTGTGTAAGCATCTCAGCACTGGCAGGGGTCTCCACATGGCTGCTCC
AGCACCCAGGGCTGCATCTGGGTAGGTCCATGTGGCTTCTCCTTGGGGATGTCTTGCAGG
AAGTGAGCCTTGCCAGCTGAAGCAGGGAACTTCCTAAGGCAGCTGCACCTGGTCCAACCA
TCAGAAAGCAAGAGACCCGAGAATTAGAAGGTGAGGCTCACTGAGCCATTTATCTCTCCA
CCCTTCAATTAATCCTGCATGGGTTTATCGGCCAGATTAAACAAATAAACCTTTACTATC
TCAAGGCCCCTGGCTGGTCTCCTTTCCCTTCCACCCACTGGTGTGTTTGATCAGGTCTTG
CAAGGCTTCTAATGGACATGCAACTAACTAGTTCTTACTGTGCATGTTATTGCATACTTA
ATCTAGGCAACCCCTTTCTCTTTTGGGGCCTGTTGTCTCTCATTGATTGGCTTTGGGGAA
CAACCCCTCTTCCCTAAGCTTCCTGCCTAACATTCAGACATACAATAATAAGAAATTATT
GCTGTGGTATTGATTGTGAGTCATAGAGACCCTAACAATCTAGAACTACTTTGAAGAGCT
TCCTTGGCTATCATCATGGCAGAAGCTGAATGCCAGGCCTTTCTTCCATGGCACCCTTGG
TGAGTTCACCTTGTCTACTTTGATGTTAGTGTTTAAGTGCAAACCATTGTCATGACTCTG
AGGCCATGCAAAAATGCAAACTCCCATTAGAAGTTGAACCAGCACAGTGATGGTACTATT
TTTTGCCAACAGCAGTTCACCTAGTGAATGTTGATAGTGTTGGGTCTGAGTGAAGCTGAA
AAAAAATAAAGAAGTTGAACCAAAAGTTCCTTAAATCTTTTACCTTGGAAAGCTAGAAAT
GATTGATATGTAAAATAAAGTGACATATTTTGTTTTCATTTTTTAGAAAACAAAATGACA
CATGTTTGAAGGACAATGATACAAAAATATTATCTCTGCTCTGTAGCTGATGGTATTCAT
GGCAGTTTACAAAAATTAATTCAGTGGTGCTAACTGATTATAGATGGCTACCTAAAACAA
ATTCCAACTTTCTTTAATCAATTTAAAGTGTCTCTTTTTCAAAGACTTTGACACCGTTTA
AAGTGATAAAGTGGTCATAGAAAACATGGTATTACATCAACCTAGGAATTGCCCTCACAG
AAAAATCAGCACAATTATCCAACTGTATGTTGAAGTGAAGTGGATTCACAGCCTATTTTT
CCATGACTGATTTCAAAGAACCATAAAAAAAAAAAATCCCTTAGGGATGCAGGTTGATGG
GCTTCGCGTGTCAAATGGCATCACGTAAATTGTACTTCTGCCCACCCCTTATTGACTCAG
CTACTTTCAGGTACCTAATTTTTCCAAATTCTTCCAAATCTTGTACAGATTCTTTTATTT
GTGGGATAAGCAAATCTGAAAATACTTTAAGTAAGGTATGAGAGCAAATCGAAATTTGAA
CAGTGTGCAAACTTATTCAAATTGAGCCTATTTTTAGATGCCTTCTCAGAATGGACAGTT
ATGAAGTGCTTCTTTAGTTTTGCTGCCTTTGTGCTTACATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved