Echinops_telfairi Locus Poly:6:SNORA73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Poly:6:SNORA73
Echinops_telfairi
Poly:6:SNORA73
GeneScaffold_8570
SNORA73, SNORA73
1001..1207, 3126..3332
3467
CACCCCTCTTCAGACAGTTTACCTTTCTCAAGATAGCTTTTTTTTCTATTTTGCATACT
TAATATACCGAAGTATTTGGGGGAAGTTTACCTAAAGGCATAAACGCCACATTGGTGAAC
TGAATGCGCAGAAGGAGATGTCCAGAGTGGCCCAGGGTGCGGAGACCGACCACAAAACCC
AGGCTCTGTCCTTCCTTGTCGCCCGGCTCTGCACTGCTGCCGGGCACAGCTCGGCCGCCA
GGGGGCTCCGAGCGGGCGGGGGGCGGAGCCTAACCTGCCGTCCATTCCCGGCACCCTTCG
CGGTTTCTGGGTCCTTCCCCCGCGCAGGTTACCGCGCAGGCGCAATAGGCATTCCTTAAC
CACCGCGCCCTTTGGGTGGGGTACCTGGGATTCTTTATCTTCCGGCGGCTCTGAGGGGAA
GGCGAGCCTCGGTGAGTGTCTGGGCGGCGCGTCCTCCCACCTCCAGGGCCCCGTCCTGCC
GGCACCGGCCTTGGCCGCGAGGCTGCCCTTCGGCGGCAGCTCCGCCGAGGACGCGCGTCG
TCGCGCCCGGGCCGCGCTGGGCTCGGGCCTCCCGGGGCCGCTCAGCCCGCCGGGCGCTGG
TCGCGGCGCGCGAAGCCGCGGCTGCCACGTTCCTCGTTGCTTCTGGGCGCCCTGCCTGCG
CAGCCGAGGCGCAAGCGACCTCCTTCCCGACCTCCCCCGGTTTTAGGGCTCCCCGTGGCC
TGGAGACCCCCCTGGCTGCTGCTCCTAAGCCGGAGCTTTGTGATCGGGGTAACAAGGACG
CTGCTCCTTCACCGAGACCTCGCACGAGTGTCCGTGAGCCCGTGGTTGGCTGGGAGCTCA
TTGAAAGTTCCCAAAACGCAGGGTCCTCAAGTCGGAAACCCGGATTTGGTGCACACTCTC
TTAAAGCTTTCCAGACCTCCCCAGGGAAATTGCTACCGTCTAGCTCAAGTTGTTGCTTCC
TACGGTCGCCTGTGAATTAAAGCGGTGCGGCAGTGAGCACCCCGACGTGGATGCTCCCGG
GAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATGGAGGAGCACAGGGCTCGGCGCCCC
GTGATGTACAGGCCTTTTCCACAACGTCGGAGATCAAGCCGGGCCTGGAGCCTGCGCCTG
CATATTCCTACAGCTTCTCAGAGTCCCGTGGACAATGACTGAGGAGACAAACCATGCAGG
ACACAGCCCTCTGATGCACCCCTCTGAGTCTAGGTTCTAGTCTTTGGTGTTCTGGACTTG
TGTTTTAGTTCCCTGGGGCCGAATTCCAAGTGTCTCATTAATGTGAGTAAATATGCTCCG
GATTATGGATTTTGCATATCAGCATCTACTCTGGTGGGGAGTGTCTGGGTGTTTCGGTCA
TTTGAAACCACAGATACCTGTTACCTTATAAGGCACATTTTTACTGGTTGCCCTCCGATG
AAAAACCCTTTGTGCTAAGTTATGTGTAGTATTAAATTAAATTGTTGAGGGGGGTTTAGG
GGGTAAGGGGCTAGCCCCCACCCACTGCTACTACTACTACTAATACTACCCACGGGTTCA
GTAAGCACAATTGTACGGTTGAGATATATAAGTATTAAAATAATCGAGAGCATGAGAGAT
ACAATAATGCAGTTAGACACATTACATGGTAGCATTGCTCACCTAAGCCCAGCTTGGTGG
CCCACGTGGAGAGGGAGAAGGGAAAGAGGGCAAGGGAACAAGGGAGACAGGACTGGAGAG
GAGAGGGGAACCAGAGAGAGAGAGCTCTATATTGCTGACCCATGCCTATATACCTTTTAG
GGGCATGCTAGCCCACTAATTACAGGTAGAGACATATGTGACAGGGAGGGGCTACACTAT
AGGTTACACAGTAATGAGGGGGTGGTCTCTGGGTCGCCATAGGAACCATTATCAGTAGTG
TGAAAACTCCGCCTACAGGAGCCTGTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTAACAAATGAATCATATCAGCATCCTTCCTCACCTTCTTTTACCCATAC
TCATCAGGAAAAAGAAAAATACACCAATCTACTTGACCCCTCCCATTTTTTGGGTGGGAG
TTAGAAAGACTATGCCTAGAAGAGCCATATCTGATAAGCCACGATACCACAACTATTAAC
CTTACATGGGAAGTTCTTACACACACTCTACATTGAGTCCTGTGATTCAGAACACTGTGC
TTCTGCGTTACTTGATAAATGCAGGTTATAAAATTATTTTAATTCTATTGAGCATTGATT
ACTGTTTCTGAGTTTGATATAAGCCGGGTCATGTGTTTTATGATATTTTTGTAAGCATGT
TGACAATTTCTTAGATGTATTTTCCTACTCTGTGATGAATGGTTTTTACTCAACTCGGTA
AAACAGTGCTAAGATTTTCACCTCTGCATTCTCACCACCTGAGGGAGAGATGTATGGAGA
ATTTTTAAATGAGGAAATGTAGTAGATAAGCCATATAGAACAATGGCAATCATGCAATGT
AGTTTTGGACTAGTTAAAACAATTACTAACCTCAGTGCACTTAACTTTTTTCACAGAACA
ATCTCAAGTCTACACCTGTACTCTGAGGTGAGTAAACTGAAAGTCCTTGGGAATGTTTTA
AAGGGTGAGAGTGTTGTCTAGCAGTATTACCTTTGAATGAATTTGTTTGCAGTGACTAGT
GTCATTCCAACGTGGATACTCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCAT
GGAGGAGCACAGGGCTCAGTGCCCCGTGATGTACAGTCCTTTCCCACAACGTTGGAGATC
AAGCCGGGCCTGGAGCCTGCGCCTGCATATTCCTACAGCTTCTCAGAGTCCTGTGGACAA
TGACTGAGGAGACAAACCATGCAGGAAACATGTCTAATACATGTTATATTTTTTTCATTG
AAGAAGCTTTAGCAGGAGTTTAAACCTATATATATTTTTATGGCTTCATTTAGGAGAGGA
ATCTGTCTTACCTTAGGACAGGACTTCCTCCTGCCCCCCGCCCTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved