Echinops_telfairi Locus Mono:263:SNORD73
snOPY snoRNA Orthological Gene Database
Echinops_telfairi Mono:263:SNORD73
Echinops_telfairi
Mono:263:SNORD73
scaffold_309080
SNORD73
1001..1072
2072
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCACAAGAATCAGTGGTTGGTTGAGGACTGTCTCTTGGTTTATATGCCCTCGA
ACCATCTTGGGAGCAGCAACTTCTAGTTAGTTTTACTGGGGTCCCCTCTTCATTGCTTCT
GGCAGTAGTGACATTGTGATGTTAAGTTGAAATCATGACTGGTCCATTAACAGGTGACTT
CTTTTTGACTATTAAGCTTGGTAATCCTTGGGGGCTGGAGATAGAATTATCTCAGGGAAT
TTCTAAGGATTCTCCCCACCCCACCCCAAGGATTCTTAGCACACCACCTGACACAGAAAA
CATGCACAGATAATTATTACAGGAAATTGCATTAATTCTGTTGTGGGTCTGGCCAACATC
CAGCTATTTCAACCAAGTGCAAAATGGTTTTTGTGTGTGGGAATGAAGGATGACAAAATG
TTTCGGTCCCAAATGATCGTACTGATTATACCGTTATGTTTGGTTCTGACATTCCCTTAC
CGTGTTCTCTGTTTTGTTTGTAGCACTATTTTGAGGTTCCTTTTGGTGGTTCTGAGTTAG
GCTTTCGGCTGCCAACCCACCATTCCCTTTGTGGGAAAAAGGCGGCCTGCATAAAGATTG
ATGGTCTCATAGCAACCCTGTATATTGTTGGCATGACTTTGTGTTGATGGGACATACTTT
TATTTTTTTAATGCTTAGTCTTAGTAAATGGGTACGAGTTGGATTGTTAACTGGAAGGCC
CAGGCAGGGCTCAAACCCACCAATTGTTCTGTGGGAGGAAGATTTTGGATCAGCATTATG
AGGAACTTGATGGCAGTGAGGTTAAACAAGCTTCACACTTTCTGAATCCATTTTGAGCAT
TAAGTGTAGGTGTCCCTGTTGCTTTCTGTAGCAATTACATTTAACTCACCCAAGTTGTAG
TGTAGGCATTTTTTTCCGGTAAGGGGGATGGTGTTTAGGTGTGGAAGTGAGTACAGGTGA
ACTGGCTAAAAGGTCTAGGTAGGTACCGTACTTACTTGGATATGATGGATGGAGGGAATT
GGGGACAATCAGTGGTAACGTCTTTGAATGAGGATTTGACAACCCATTTTGCTGTGTTAT
TAGCGCTTGAGGGATAAAAACTGGTGAAACATTTTTTTCCCCTAGACCATGATTGAAGCT
CATGTTGATGTCAAGACTACCGATGGGTATCTACTTCGTCTGTTCTGTGTTGGTTTTACT
AAAAAACGCAATAATCAGATTCGGAAGACCTCTTACGCTCAGCACCAGCAGGTTCGCCAA
ATCCGAAAGAAAATGATGGAAATCATGACCCGAGAGGTGCAGACAAATGACTTGAAAGAA
GTGGTCAATAAGTTGTAAGTATCTGACCTTTTTTTCCTTCCTTCCTGTGAATCGTAGGTG
AAAGCGTTTTTTAAGTGCTTAGTAAATGTTTGGTTTCTTTGAGGAAGTAACCTCATGGCA
CTAAGACTTGAGGACAAGAAATGCTTTTGTNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved